&lt;p&gt;WHSC1 acts as a prognostic indicator and functions as an oncogene in cervical cancer&lt;/p&gt;

Wu, Jin; Luo, Ming; Duan, Zhaoning; Jia, Ying; Linghu, Hua; Tian, Pu; Qi, Hongbo

doi:10.2147/ott.s204701

Cited by 12 publications

(8 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The primers of WHSC1 were: F, 5′- ATTTAGCATCAAGCAGAGTCCC -3′; R, 5′- CGCAGTTTGGCATCGTGT -3′. 17 The relative mRNA WHSC1 expression was analysed using the 2 –ΔΔCt method by normalising to β-actin.…”

Section: Methodsmentioning

confidence: 99%

Wolf–Hirschhorn syndrome candidate 1 facilitates alveolar macrophage pyroptosis in sepsis-induced acute lung injury through NEK7-mediated NLRP3 inflammasome activation

Liu

Cai

et al. 2021

Innate Immun

View full text Add to dashboard Cite

Sepsis is a complex clinical syndrome with high incidence and mortality. Acute lung injury (ALI) is a common complication of sepsis. At present, there is no effective therapeutic strategy to treat ALI. The SET domain–containing histone methyltransferase Wolf–Hirschhorn syndrome candidate 1 (WHSC1) regulates cancer progression, while its role in sepsis-induced ALI remains unclear. Thus, this study aimed to study the effect of WHSC1 on sepsis-induced ALI and to explore the potential mechanism of action. In the study, LPS treatment induced lung injury. WHSC1 was highly expressed in LPS-induced ALI. Knockdown of WHSC1 attenuated LPS-induced ALI and pyroptosis in vivo. Besides, knockdown of WHSC1 attenuated LPS-induced alveolar macrophage pyroptosis in vitro. Furthermore, NIMA-related kinase-7 (NEK7) expression could be regulated by WHSC1, and NEK7 bound to NLRP3 in alveolar macrophages. Moreover, WHSC1 regulated alveolar macrophage pyroptosis through modulating NEK7-mediated NLRP3 inflammasome activation. In conclusion, WHSC1 was highly expressed in LPS-induced ALI. WHSC1 facilitated alveolar macrophage pyroptosis in sepsis-induced ALI through NEK7-mediated NLRP3 inflammasome activation. WHSC1 may be a valuable target for the therapy of sepsis-induced ALI.

show abstract

Section: Methodsmentioning

confidence: 99%

Wolf–Hirschhorn syndrome candidate 1 facilitates alveolar macrophage pyroptosis in sepsis-induced acute lung injury through NEK7-mediated NLRP3 inflammasome activation

Liu

Cai

et al. 2021

Innate Immun

View full text Add to dashboard Cite

show abstract

“…Likewise, Yin et al 78 reported that the overexpression of NSD2 promotes cervical cancer by inducing AKT/MMP-2 signaling pathways. Wu et al 79 demonstrated that NSD2 overexpression contributes to proliferation, migration, and invasion of cervical cancer via the endothelial nitric oxide synthase (eNOS) signaling pathway. Similarly, Jones et al 80 reported that the amplification of NSD3−BRD4−CHD8 is observed in pelvic high-grade serous carcinoma (HGSC) of ovarian and endometrial origin (Figure 5).…”

Section: Functions Of Nsd1 Nsd2 and Nsd3 Inmentioning

confidence: 99%

Targeting the Nuclear Receptor-Binding SET Domain Family of Histone Lysine Methyltransferases for Cancer Therapy: Recent Progress and Perspectives

et al. 2021

View full text Add to dashboard Cite

Nuclear receptor-binding SET domain (NSD) proteins are a class of histone lysine methyltransferases (HKMTases) that are amplified, mutated, translocated, or overexpressed in various types of cancers. Several campaigns to develop NSD inhibitors for cancer treatment have begun following recent advances in knowledge of NSD1, NSD2, and NSD3 structures and functions as well as the U.S. FDA approval of the first HKMTase inhibitor (tazemetostat, an EZH2 inhibitor) to treat follicular lymphoma and epithelioid sarcoma. This perspective highlights recent findings on the structures of catalytic su(var), enhancer-of-zeste, trithorax (SET) domains and other functional domains of NSD methyltransferases. In addition, recent progress and efforts to discover NSD-specific small molecule inhibitors against cancer-targeting catalytic SET domains, plant homeodomains, and proline-tryptophan-tryptophan-proline domains are summarized.

show abstract

“…57,58 Wu et al have displayed that a high level of NSD2 is associated with differentiation and stage, depletion of NSD2 inhibits cell proliferation, migration, and invasion, and this is affected by endothelial nitric oxide synthase (eNOS) signaling pathway. 57 In agreement with Wu, Yin et al have shown that up-regulation of NSD2 significantly promotes the proliferation, migration, and invasion of cancer cells, and the underlying mechanism may be attributed to the activation of the AKT/metalloproteinase-2 (MMP-2) signaling pathway upon over-expression of NSD2. 58 Zhu et al have confirmed that the growth of cancer cells is reduced after depletion of NSD2 in vivo and in vitro.…”

Section: Nsd2 In Cancers Of Female Reproductive Systemmentioning

confidence: 99%

<p>The Role of Methyltransferase NSD2 as a Potential Oncogene in Human Solid Tumors</p>

Chen¹,

Chen²,

Zhao³

et al. 2020

OTT

View full text Add to dashboard Cite

Malignant solid tumors are the leading cause of death in humans, and epigenetic regulation plays a significant role in studying the mechanism of human solid tumors. Recently, histone lysine methylation has been demonstrated to be involved in the development of human solid tumors due to its epigenetic stability and some other advantages. The 90-kb protein methyltransferase nuclear receptor SET domain-containing 2 (NSD2) is a member of nuclear receptor SET domain-containing (NSD) protein lysine methyltransferase (KMT) family, which can cause epigenomic aberrations via altering the methylation states. Studies have shown that NSD2 is frequently over-expressed in multiple types of aggressive solid tumors, including breast cancer, renal cancer, prostate cancer, cervical cancer, and osteosarcoma, and such up-regulation has been linked to poor prognosis and recurrence. Further studies have identified that over-expression of NSD2 promotes cell proliferation, migration, invasion, and epithelial-mesenchymal transformation (EMT), suggesting its potential oncogenic role in solid tumors. Moreover, Gene Expression Profiling Interactive Analysis (GEPIA) was searched for validation of prognostic value of NSD2 in human solid tumors. However, the underlying specific mechanism remains unclear. In our present work, we summarized the latest advances in NSD2 expression and clinical applications in solid tumors, and our findings provided valuable insights into the targeted therapeutic regimens of solid tumors.

show abstract

<p>WHSC1 acts as a prognostic indicator and functions as an oncogene in cervical cancer</p>

Cited by 12 publications

References 20 publications

Wolf–Hirschhorn syndrome candidate 1 facilitates alveolar macrophage pyroptosis in sepsis-induced acute lung injury through NEK7-mediated NLRP3 inflammasome activation

Wolf–Hirschhorn syndrome candidate 1 facilitates alveolar macrophage pyroptosis in sepsis-induced acute lung injury through NEK7-mediated NLRP3 inflammasome activation

Targeting the Nuclear Receptor-Binding SET Domain Family of Histone Lysine Methyltransferases for Cancer Therapy: Recent Progress and Perspectives

<p>The Role of Methyltransferase NSD2 as a Potential Oncogene in Human Solid Tumors</p>

Contact Info

Product

Resources

About