&lt;p&gt;Yes-Associated Protein Contributes to Cell Proliferation and Migration of Gastric Cancer via Activation of Gli1&lt;/p&gt;

Han, Ting; Cheng, Zhengwu; Xu, Menglin; Wang, Xiaoming; Wu, Jian; Fang, Xiaosan

doi:10.2147/ott.s266449

Cited by 6 publications

(6 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Gli1 was silenced in HCT116 cells with or without LATS1 depletion to see if it was involved in LATS1 regulation of CRC cell proliferation and migration and it was observed that LATS1 knockdown promoted the migration and proliferation of HCT116 cells, but the enhanced proliferation and migration ability was greatly impaired when Gli1 was depleted, indicating the dependence of anti-carcinogenic roles of LATS1 on Gli1. Given the facts that LATS1 is a critical regulator of YAP1 [5] and YAP1 can upregulate Gli1 expression in esophageal squamous cell carcinoma [30] and gastric cancer [31], we speculated that YAP1 might be implicated in LATS1-mediated Gli1 suppression. Here, we confirmed that LATS1 depletion promoted YAP1 expression while LATS1 elevation inhibited YAP1 expression in CRC cells.…”

Section: Discussionmentioning

confidence: 99%

“…Given the facts that LATS1 is a critical regulator of YAP1 5 and YAP1 can upregulate Gli1 expression in esophageal squamous cell carcinoma 30 and gastric cancer 31 , we speculated that YAP1 might be implicated in LATS1-mediated Gli1 suppression. Here, we confirmed that LATS1 depletion promoted YAP1 expression while LATS1 elevation inhibited YAP1 expression in CRC cells.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

LATS1 exerts tumor suppressor functions via targeting Gli1 in colorectal cancer

Shen¹,

Pan²,

Chen³

et al. 2021

J. Cancer

Self Cite

View full text Add to dashboard Cite

Background: The Hippo pathway's primary kinase component, large tumor suppressor 1 (LATS1), has been hypothesized as a tumor suppressor in a variety of cancers. LATS1's biological effects on colorectal cancer (CRC) are yet to be determined. Methods: The analysis of LATS1 mRNA expression in CRC was conducted using public databases from the Gene Expressing Profiling Interactive Analysis database (GEPIA). Investigation for the expression of LATS1 protein in 102 CRC tumor tissues and 57 normal tissues was performed using immunohistochemistry (IHC) analysis. In vitro genetic manipulation was used to explore the potential role and mechanism of LATS1 in the regulation of proliferation and migration of CRC cells. Results: LATS1 was found to be considerably downregulated in CRC tissues, with much lower levels in individuals with bigger tumors of size (≥5 cm), deeper invasion (T3-4), positive lymph node metastasis (LNM), and advanced tumor-node-metastasis (TNM) stage (III-IV). As exhibited by clinical data analysis, LATS1 loss was significantly associated with TNM and LNM staging in CRC patients. Furthermore, our in vitro investigations revealed that LATS1 depletion increased CRC cell proliferation and migration in HCT116 cells, whereas overexpressing LATS1 had the opposite effect in SW620 cells. LATS1 suppressed the expression of glioma-associated oncogene-1 (Gli1), and LATS1's tumor-suppressive actions in CRC are dependent on Gli1. Moreover, LATS1 could modulate Yes-associated protein 1 (YAP1) expression and mTOR activation in CRC cells. Conclusion: Our findings identify the LATS1 as a unique Gli1 regulator in CRC cell migration and proliferation, and suggest that LATS1 may serve as a potential therapeutic target for CRC.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

LATS1 exerts tumor suppressor functions via targeting Gli1 in colorectal cancer

Shen¹,

Pan²,

Chen³

et al. 2021

J. Cancer

Self Cite

View full text Add to dashboard Cite

show abstract

“…In gastric cancer, FLangan et al found that Wnt receptor Fzd7 played an essential role in gastric tumorigenesis [48]. YAP was also reported to enhance GC cell proliferation and migration by regulating Gli1 expression via the non-classical Hedgehog pathway [49]. We observed that β-catenin binds to the promotor region of YAP, upregulating YAP expression and correlates with poor prognosis.…”

Section: Discussionmentioning

confidence: 49%

Yes-associated protein gene overexpression regulated by β-catenin promotes gastric cancer cell tumorigenesis

Qiu

Zhang

et al. 2022

THC

View full text Add to dashboard Cite

BACKGROUND: Yes-associated protein (YAP) has been reported to act as a candidate human oncogene and played a critical role in the development of multiple cancer types. OBJECTIVE: We aimed to investigate the expression, function, and underlying mechanisms of YAP in gastric cancer (GC). METHODS: Expression levels of YAP in gastric tissues were tested. CCK8 assay, clonogenic assay, apoptosis assay, transwell assay, cell scratch assay and animal study were conducted to explore the function of YAP. Chromatin immunoprecipitation (ChIP) assay and luciferase reporter assay were performed to explore the underlying mechanism. Survival analysis was carried out to reveal the relationship between YAP and clinical outcome. RESULTS: YAP was upregulated in gastric cancer tissues and correlates with poor prognosis. YAP could promote GC cells proliferation, metastatic capacity, inhibit GC cells apoptosis in vitro and in vivo. Bothβ-catenin and YAP were mainly localized withi the tumor cell nuclei. β-catenincould upregulate YAP expression by binding to the promotor region of YAP. Patients with both YAP and β-catenin negetive expression had a better prognosis than others. CONCLUSIONS: YAP overexpression is driven by aberrant Wnt β-catenin signalingand then contributed to the GC tumorigenesis and progression. ThusYAP might be a potential target for GC treatment.

show abstract

“…To knockdown (KD) TYRO3 expression, TYRO3 shRNA oligonucleotides were designed, synthesized, and transfected into AGS and MKN74 cells with 50 nM of the Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen) according to the manufacturer's instructions. AGS and MKN74 cells stably expressing TYRO3‐specific shRNA (KD) and mock transfection (a negative control [NC]) were generated using the lentivirus shRNA technique 19 . The human TYRO3 shRNA target sequence was CAAAGAGATGTCCTTGTAATA 20 .…”

Section: Methodsmentioning

confidence: 99%

“…AGS and MKN74 cells stably expressing TYRO3-specific shRNA (KD) and mock transfection (a negative control [NC]) were generated using the lentivirus shRNA technique. 19 The human TYRO3 shRNA target sequence was CAAAGAGATGTCCTTGTAA TA. 20 After 48 h of transfection, the AGS and MKN74 cells were collected and shRNA transfection efficiencies were detected through western blot analysis and quantitative real-time PCR (qRT-PCR).…”

Section: Shrna Transfectionmentioning

confidence: 99%

Overexpression of TYRO3 indicates poor prognosis and induces gastric cancer progression via AKT‐mTOR pathway

Wang

Cheng

Dai

et al. 2023

Molecular Carcinogenesis

Self Cite

View full text Add to dashboard Cite

Gastric cancer (GC) is among of the leading causes of cancer mortality worldwide. This is because many patients are diagnosed with advanced GC and postoperative radiotherapy and chemotherapy have also exhibited limited effects on GC. TYRO3 has been considered carcinogenic and a potential therapeutic target for GC. However, TYRO3 function and mechanism in GC remains elusive. The study results indicated that TYRO3 was aberrantly elevated in GC tissues and predicted poor prognosis. TYRO3 is closely associated with clinicopathological indicators in GC tissues such as lymph node metastasis, venous invasion, neural invasion, and the tumor‐node‐metastasis stage. In addition, TYRO3 expression levels are closely related to the AKT‐mTOR pathway in GC tissues. Moreover, the oncogenic role of TYRO3 was determined through in vitro and in vivo functional assays, and knockdown of the TYRO3 expression level in GC cell lines can effectively suppress the AKT‐mTOR pathway and inhibit tumor cell proliferation and migration. In conclusion, this study provides a theoretical basis for establishing the potential association and regulatory mechanism between TYRO3 and AKT‐mTOR and offers a new strategy for GC‐targeted therapy.

show abstract

<p>Yes-Associated Protein Contributes to Cell Proliferation and Migration of Gastric Cancer via Activation of Gli1</p>

Cited by 6 publications

References 32 publications

LATS1 exerts tumor suppressor functions via targeting Gli1 in colorectal cancer

LATS1 exerts tumor suppressor functions via targeting Gli1 in colorectal cancer

Yes-associated protein gene overexpression regulated by β-catenin promotes gastric cancer cell tumorigenesis

Overexpression of TYRO3 indicates poor prognosis and induces gastric cancer progression via AKT‐mTOR pathway

Contact Info

Product

Resources

About