LysA2, the Lactobacillus casei bacteriophage A2 lysin is an endopeptidase active on a wide spectrum of lactic acid bacteria

Antibodies Targeting Hsa and PadA Prevent Platelet Aggregation and Protect Rats against Experimental Endocarditis Induced by Streptococcus gordonii

“…This system is based on non-genetically modified L. lactis used as a vehicle for antigens bound on the surface by means of a highaffinity cell-binding domain (CBD) from L. casei A2 phage lysine LysA2 (24). Such a system offers some advantages over a previously used immunization method based on recombinant L. lactis expressing bacterial antigens, such as the Staphylococcus aureus clumping factor A (ClfA) or the fibronectin binding protein A (FnbpA) (26).…”

“…The N-terminal regions coding for amino acids (aa) 39 to 449 of hsa and 35 to 1327 of padA were PCR amplified from S. gordonii genomic DNA using forward primers hsa-fw (ATATGGATCCTTTAAGATTAATGAAGGGTGCTG) and padA-fw (ATATGGATCCTGATCCTCTGAATATTGAGACG) containing BamHI recognition sites (underlined) and reverse primers hsa-rv (TATACGGCCGTACTAATCTGAAGATCTTTAAC) and padA-rv (TAT ACGGCCGCTTCCAAGGTATCAGAAAGTACA) containing EagI recognition sites (underlined). The resulting products of 1,258 bp and 3,901 bp were digested with BamHI and EagI (Promega, Madison, WI) and ligated into the pLysA2 vector, a plasmid containing the gene coding for bacteriophage A2 of L. casei (24), previously digested with the same enzymes. The resulting constructs, namely, pHsa-LysA2 and pPadA-LysA2, encoded the N-terminal regions of Hsa and PadA with an N-terminal 6-His tag and Xpress epitope and fused to the cell-binding domain of L. casei LysA2 at the C terminus (Fig.…”

“…Hsa (aa 39 to 449), PadA (aa 35 to 1327), Hsa-LysA2, and PadA-LysA2 were purified as previously described (24). Briefly, E. coli BL21(DE3)pLysS containing pHsa, pPadA, pHsa-LysA2, and pPadA-LysA2 was grown aerobically at 37°C in LB containing ampicillin (100 g/ml) until the mid-exponential phase (optical density at 600 nm [OD 600 ], ϳ0.5).…”

“…S. gordonii Challis (strain DL1) (19) was grown at 37°C in brain infusion broth (Difco-Becton Dickinson) in the presence of 5% CO 2 . Escherichia coli DH5␣ (Invitrogen, Carlsbad, CA) and E. coli BL21(DE3)pLysS (24) were grown in LuriaBertani (LB) broth (Difco-Becton Dickinson).…”

“…In the present study, we employed a recently developed antigen display system (23) to immunize rats with both adhesins. This system is based on nonliving, non-genetically modified Lactococcus lactis cells displaying on the cell wall the functional N-terminal region (directly involved in platelet activation) of Hsa or PadA fused to the C-terminal domain of Lactobacillus casei A2 phage lysine (LysA2), which was previously shown to bind to the cell wall of a wide spectrum of lactic acid bacteria (24). The immunizations with L. lactis displaying HsaLysA2 (L. lactis Hsa-LysA2) and L. lactis displaying PadA-LysA2 (L. lactis PadA-LysA2), individually or after coimmunization, were evaluated for their ability to induce specific antibodies in rats and to protect against S. gordonii experimental IE.…”