Lysyl Oxidase Activity Is Required for Ordered Collagen Fibrillogenesis by Tendon Cells

Herchenhan, Andreas; Uhlenbrock, Franziska; Eliasson, Pernilla; Weis, MaryAnn; Eyre, David R.; Kadler, Karl E.; Magnusson, S. Peter; Kjær, Michael

doi:10.1074/jbc.m115.641670

Cited by 144 publications

(102 citation statements)

References 61 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The sequential ionic and covalent crosslinking of aECM here is analogous to how collagen is covalently modified in tissues. Following collagen self-assembly, enzymatic crosslinking by lysyl oxidase further crosslinks assembled collagen fibers [26, 36, 37] to alter their mechanical properties without altering the overall ECM content of the tissue [38]. Together, these studies demonstrate one approach to build complex hierarchical structures of extracellular matrix with tunable mechanical properties.…”

Section: Discussionmentioning

confidence: 99%

Sequential modes of crosslinking tune viscoelasticity of cell-instructive hydrogels

2019

View full text Add to dashboard Cite

Materials that can mimic the fibrillar architecture of native extracellular matrix (ECM) while allowing for independent regulation of viscoelastic properties may serve as ideal, artificial ECM (aECM) to regulate cell functions. Here we describe an interpenetrating network of click-functionalized alginate, crosslinked with a combination of ionic and covalent crosslinking, and fibrillar collagen type I. Varying the mode and magnitude of crosslinking enables tunable stiffness and viscoelasticity, while altering neither the hydrogel’s microscale architecture nor diffusional transport of molecules with molecular weight relevant to typical nutrients. Further, appropriately timing sequential ionic and covalent crosslinking permits self-assembly of collagen into fibrillar structures within the network. Culture of human mesenchymal stem cells (MSCs) in this mechanically-tunable ECM system revealed that MSC expression of immunomodulatory markers is differentially impacted by the viscoelasticity and stiffness of the matrix. Together, these results describe and validate a novel material system for investigating how viscoelastic mechanical properties of ECM regulate cellular behavior.

show abstract

Section: Discussionmentioning

confidence: 99%

Sequential modes of crosslinking tune viscoelasticity of cell-instructive hydrogels

2019

View full text Add to dashboard Cite

show abstract

“…After 24 h, total RNA was extracted using TRIzol reagent (Invitrogen), and 1 μ g of RNA was converted into cDNA using the ImProm‐II Reverse Transcription System (Promega, Madison, WI, USA). Quantitative real‐time PCR procedures were performed using LightCycler 480 SYBR Green I Master (Roche Diagnostics, Mannheim, Germany), an equal amount of cDNA, and specific primers for genes encoding type I collagen and its modifying enzymes, as follows: collagen type I alpha‐2 chain ( COL1A2 ) , 5′‐TAATGGGGAAGCTGGATCTG‐3′ (forward) and 5′‐GTCCCTGAGCACCATTGTTT‐3′ (reverse); LH1 ( PLOD1 ) , 5′‐GAAGCTCTACCCCGGCTACT‐3′ (forward) and 5′‐CTTGTAGCGGACGACAAAGG‐3′ (reverse); LH2 ( PLOD2 ) , 5′‐GGGAGTTCATTGCACCAGTT‐3′ (forward) and 5′‐GAGGACGAAGAGAACGCTGT‐3′ (reverse); LH3: PLOD3 , 5′‐CACTACGGCCAGTGGTCAG‐3′ (forward) and 5′‐GTGGGCACATTCTCGTAGC‐3′ (reverse); GLT25D1 ( GLT25D1 ) , 5′‐GATGCTGCCTGTGGACGAGTTC‐3′ (forward) and 5′‐CTCACATAGCCATCGTCTCCTG‐3′ (reverse); LOX ( LOX ) , 5′‐CGCTGTGACATTCGCTACACAGGAC‐3′ (forward) and 5′‐CATTGGGAGTTTTGCTTTGCCTTCT‐3′ (reverse); and glyceraldehyde‐3‐phosphate dehydrogenase ( GAPDH ) , 5′‐GCTCTCCAGAACATCATCC‐3′ (forward) and 5′‐GTGTCGCTGTTGAAGTCAG‐3′ (reverse). Results were analyzed using the LightCycler 480 Instrument (Roche Diagnostics).…”

Section: Methodsmentioning

confidence: 99%

Comparative evaluation of periodontal ligament fibroblasts stored in different types of milk: effects on viability and biosynthesis of collagen

Sinpreechanon

Boonzong

Sricholpech

2019

European J Oral Sciences

View full text Add to dashboard Cite

Milk remains one of the most frequently recommended solutions for storage of avulsed teeth because it can maintain cell viability and is easily accessible. However, some negative effects of milk on avulsed teeth have been reported, just as the effects of milk on the long‐term functions of cells are not clear. This study aimed to evaluate the effects of different types of milk on the viability, proliferation, and functions of periodontal ligament fibroblasts (PDLF)s in vitro. Human PDLFs were culture‐medium depleted for 5 min and stored in Hanks’ balanced salt solution (HBSS), whole cow's milk, low‐fat cow's milk, or almond milk for 1 h at 25°C. Cell viability and proliferation were assessed using MTT assays. Expression of the genes encoding type I collagen and its modifying enzymes were analyzed using real‐time PCR. Collagen matrix production was evaluated using Picrosirius red polarization. Our results showed the overall efficiency of low‐fat cow's milk in maintaining the viability and proliferation of PDLFs, and in enhancing the process of collagen production. Almond milk storage resulted in the highest rate of PDLF proliferation, and comparable collagen biosynthesis ability to the control. Therefore, besides low‐fat cow's milk, almond milk may potentially be an alternative tooth‐storage medium for PDLF preservation and PDL tissue regeneration.

show abstract

“…42 It was beyond the scope of the present study to measure these factors. Clearly, tendon mechanical properties can be influenced by other factors than the fibril structures, and enzymatic as well as non-enzymatic cross-links have been shown to influence tendon stiffness.…”

mentioning

confidence: 96%

Early development of tendinopathy in humans: Sequence of pathological changes in structure and tissue turnover signaling

et al. 2019

Self Cite

View full text Add to dashboard Cite

Overloading of tendon tissue with resulting chronic pain (tendinopathy) is a common disorder in occupational-, leisure-and sports-activity, but its pathogenesis remains poorly understood. To investigate the very early phase of tendinopathy, Achilles and patellar tendons were investigated in 200 physically active patients and 50 healthy control persons. Patients were divided into three groups: symptoms for 0-1 months (T1), 1-2 months (T2) or 2-3 months (T3). Tendinopathic Achilles tendon crosssectional area determined by ultrasonography (US) was ~25% larger than in healthy control persons. Both Achilles and patellar anterior-posterior diameter were elevated in tendinopathy, and only later in Achilles was the width increased. Increased tendon size was accompanied by an increase in hypervascularization (US Doppler flow) without any change in mRNA for angiogenic factors. From patellar biopsies taken bilaterally, mRNA for most growth factors and tendon components remained unchanged (except for TGF-beta1 and substance-P) in early tendinopathy. Tendon stiffness remained unaltered over the first three months of tendinopathy and was similar to the asymptomatic contra-lateral tendon. In conclusion, this suggests that tendinopathy pathogenesis represents a disturbed tissue homeostasis with fluid accumulation.

show abstract

Lysyl Oxidase Activity Is Required for Ordered Collagen Fibrillogenesis by Tendon Cells

Cited by 144 publications

References 61 publications

Sequential modes of crosslinking tune viscoelasticity of cell-instructive hydrogels

Sequential modes of crosslinking tune viscoelasticity of cell-instructive hydrogels

Comparative evaluation of periodontal ligament fibroblasts stored in different types of milk: effects on viability and biosynthesis of collagen

Early development of tendinopathy in humans: Sequence of pathological changes in structure and tissue turnover signaling

Contact Info

Product

Resources

About