Maize defective kernel mutant generated by insertion of a Ds element in a gene encoding a highly conserved TTI2 cochaperone

Abstract

We have used the newly engineered transposable element to tag a gene that gives rise to a defective kernel () phenotype. requires the autonomous element for transposition. Upon excision, it leaves a short DNA footprint that can create in-frame and frameshift insertions in coding sequences. Therefore, we could create alleles of the tagged gene that confirmed causation of the phenotype by the insertion. The mutation, designated , is embryonic lethal, has a defective basal endosperm transfer (BETL) layer, and results in a smaller seed with highly underdeveloped endosperm. The maize gene encodes a TTI2 (Tel2-interacting protein 2) molecular cochaperone. In yeast and mammals, TTI2 associates with two other cochaperones, TEL2 (Telomere maintenance 2) and TTI1 (Tel2-interacting protein 1), to form the triple T complex that regulates DNA damage response. Therefore, we cloned the maize and homologs and showed that TEL2 can interact with both TTI1 and TTI2 in yeast two-hybrid assays. The three proteins regulate the cellular levels of phosphatidylinositol 3-kinase-related kinases (PIKKs) and localize to the cytoplasm and the nucleus, consistent with known subcellular locations of PIKKs. displays reduced pollen transmission, indicating TTI2's importance in male reproductive cell development.

Maize Dek15 Encodes the Cohesin-Loading Complex Subunit SCC4 and Is Essential for Chromosome Segregation and Kernel Development

“…The defective kernel (dek) mutants are affected in the development of both the embryo and the endosperm, and were initially generated through ethyl methanesulfonate (EMS) mutagenesis of the pollen (Neuffer and Sheridan, 1980). Only a fraction of the dek mutants have been cloned and functionally characterized (Lid et al, 2002;Qi et al, 2016bQi et al, , 2017aQi et al, , 2017bGarcia et al, 2017;Wang et al, 2017;Dai et al, 2018;Li et al, 2018b). In this study, we analyzed the classic maize mutation dek15, which leads to a reduced endosperm and is embryo lethal.…”

Rapid identification and characterization of genetic loci for defective kernel in bread wheat

“…The cloned dek genes in maize are involved in the grain growth and development, especially the synthesis and storage of starches and/or proteins in the endosperm [4][5][6][7]. Our biochemical analysis also showed that the mature grain starch contents of BL33 were significantly lower than those of BL31…”

“…Totally 783 simple sequence repeat (SSR) markers were chosen from the above chromosomes and 15 of these were integrated into two linkage groups using the genetic population. Of them, the genes of dek1, dek35, dek38 and dek39 have been isolated, and all involved in the synthesis and accumulation of starches and/or proteins in the endosperm [4][5][6][7]. Many Dek mutants have been generated in wheat, but their genetic information remains largely unknown.…”

Genetic elucidation of complex biochemical traits mediating maize innate immunity

“…The Dsg insertion (dsgR102G05) in W22 Zx5 (Zm00001d014121, B73 RefGen_V4) was verified by designing PCR primer pairs, with one gene-specific pair (Supplementary Table 12) from W22 Zx5 and one primer from the Dsg GFP insertion (GFP_AC-DS: TTCGCTCATGTGTTGAGCAT) 92 .…”