Major QTLs Control Resistance to Rice Hoja Blanca Virus and Its VectorTagosodes orizicolus

Abstract

Rice hoja blanca (white leaf) disease can cause severe yield losses in rice in the Americas. The disease is caused by the rice hoja blanca virus (RHBV), which is transmitted by the planthopper vector Tagosodes orizicolus. Because classical breeding schemes for this disease rely on expensive, time-consuming screenings, there is a need for alternatives such as marker-aided selection. The varieties Fedearroz 2000 and Fedearroz 50, which are resistant to RHBV and to the feeding damage caused by T. orizicolus, were crossed with the susceptible line WC366 to produce segregating F2:3 populations. The F3 families were scored for their resistance level to RHBV and T. orizicolus. The F2:3 lines of both crosses were genotyped using microsatellite markers. One major QTL on the short arm of chromosome 4 was identified for resistance to RHBV in the two populations. Two major QTL on chromosomes 5 and 7 were identified for resistance to T. orizicolus in the Fd2000 × WC366 and Fd50 × WC366 crosses, respectively. This comparative study using two distinct rice populations allowed for a better understanding of how the resistance to RHBV and its vector are controlled genetically. Simple marker-aided breeding schemes based on QTL information can be designed to improve rice germplasm to reduce losses caused by this important disease.

Targeted promoter editing for rice resistance to Xanthomonas oryzae pv. oryzae reveals differential activities for SWEET14‐inducing TAL effectors

“…Leaf samples were collected from T0 plants and subjected to DNA extraction using a standard MATAB‐based protocol (Romero et al ., ). A portion of the OsSWEET14 promoter (342 bp in wild‐type plants) was amplified by PCR using primers 5′‐TCCAGGGTCACACACCATAAG and 5′‐TGCAGCAAGATCTTGATTAACTA.…”

Development and GBS-genotyping of introgression lines (ILs) using two wild species of rice, O. meridionalis and O. rufipogon, in a common recurrent parent, O. sativa cv. Curinga

“…Fresh leaf tissue was collected during each generation, and genomic DNA was extracted using a CTAB protocol described by Romero et al ( 2014 ). DNA concentration and quality were evaluated on 0.8 % agarose gels stained with ethidium bromide.…”

Identification of new sources of resistance to RHBV- rice hoja blanca virus

“…To determine whether the new resistance sources were different from Fedearroz 2000, single nucleotide polymorphisms were analyzed within and surrounding the QTL associated with RHBV resistance on chromosome 4, previously reported by Romero, Lozano, Garavito, Carabali, Triana, Villareal… & Lorieux (2014). The genomic region spanning from 2.81 Mbp to 3.8 Mbp was compared between Fedearroz 2000, the five new sources, and Colombia 1 (intermediate), Fedearroz 50 (highly antibiotic effect against the vector), and Bluebonnet 50 (RHBV-susceptible check).…”

“…A total of 1514 SNPs was identified in the region between 2.81 Mbp and 3.80 Mbp of chromosome 4, which includes the RHBV-resistance QTL region of Fedearroz 2000 and Fedearroz 50 (Romero et al, 2014). According to the distance-based dendrogram (Figure 2), nine accessions analyzed were classified into four groups.…”