Management of Nothofagus genetic resources: Definition of genetic zones based on a combination of nuclear and chloroplast marker data

Azpilicueta, María Marta; Gallo, Leonardo; Zonneveld, Maarten van; Thomas, Evert; Moreno, Carolina Ospina; Marchelli, Paula

doi:10.1016/j.foreco.2013.03.037

Cited by 33 publications

(29 citation statements)

References 56 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…An introgression pathway from the West into that region has been proposed, which was dated ~ 5,000 years BP based on pollen fossil records (Markgraf et al 2009); and reinforced by an isozyme analysis, since a high frequency of the isozyme allele Adh-2 was detected for both LE and northern coastal populations in Chile Gallo 2009, Azpilicueta et al 2014). However, considering Azpilicueta et al ( , 2013 and , supporting the distinctiveness of Lagunas de Epulauquen based on biochemical and molecular markers ( figure 1B and in text). B) Biochemical and molecular distinctiveness of Lagunas de Epulaquen according to number of individuals showing cpDNA haplotypes, number of individuals (Nb.…”

Section: Introductionsupporting

confidence: 60%

“…Isozyme (Azpilicueta and Gallo 2009), chloroplast (cpDNA;) and simple sequence repeat (SSR or microsatellite; Azpilicueta et al 2013) analyses revealed the presence of exclusive variants (alleles and haplotypes, figure 1B) together with higher genetic diversity parameters in this population than those found in other N. obliqua populations. Two cpDNA haplotypes were reported for LE, one fixed in N. obliqua populations north of Lanin volcano in Argentina (39° 30' S, haplotype II figure 1B) and another one found exclusively in Chilean populations (haplotype IV, figure 1B), including those located at a similar latitude to LE ).…”

Section: Introductionmentioning

confidence: 68%

“…The sampled individuals and the species and populations they belonged to -including the previously defined isozyme genotype at Adh locus -are shown in table 1. Total DNA was extracted from leaf/bud tissue according to conditions described in Azpilicueta et al (2013). The partial region of the Adh gene was amplified with the primers vF1:CTCAGGCAAAYGAAGTCCG and vR7n:AACAAAGTGGTAAATGGGCTG designed on conserved regions of sequence alignments of Fagaceae and Nothofagaceae species.…”

Section: Methodsmentioning

confidence: 99%

“…The species is distributed in ca 33,800 hectares of forests along a heterogeneous environmental landscape (Sabatier et al 2011). Notwithstanding, no identification at sub-species level has yet been done, though molecular data showed that Argentinean populations have a pronounced latitudinal distinction, with northern populations exhibiting high levels of genetic diversity (Azpilicueta et al 2013) together with shared genetic variants with populations growing at the same latitudes at the West of Andes Mountains in Chile ) (figure 1). Previous studies based on chloroplast DNA markers also revealed a genetic pattern where Chilean coastal N. obliqua populations and current forests at North of the Andes and Rucañancu could be inferred as glacial refuges for the species ), a hypothesis also supported by palynological data (Villagran 1991).…”

Section: Introductionmentioning

confidence: 99%

“…A) distribución total de los bosques de Nothofagus obliqua en Argentina y Chile (parches verdes), destacando la población septentrional Lagunas de Epulauquen en Argentina. Los óvalos incluyen las poblaciones estudiadas por Azpilicueta et al ( , 2013 y Azpilicueta y Gallo (2009), mostrando la diferenciación de Lagunas de Epulauquen con base en información de marcadores bioquímicos y moleculares (figura 1B y en el texto). B) diferenciación a nivel bioquímico y molecular de acuerdo con haplotipos de cloroplasto, número de individuos (Nb.…”

Section: Introductionunclassified

See 4 more Smart Citations

Searching for molecular insight on hybridization in Nothofagus spp. forests at Lagunas de Epulauquen, Argentina

2016

View full text Add to dashboard Cite

Estudio de la hibridación a nivel molecular en bosques de Nothofagus spp. Recently, however, its taxonomic status has been questioned due to its morphological, architectural and genetic distinctiveness. The convergence of migratory routes and hybridization with Nothofagus alpina are the two main hypotheses proposed to explain the distinctiveness of this population. Despite its unique characteristics, no evaluation of its putative origin has been carried out. In order to test the hypothesis of hybridization we analyzed nuclear Adh and ITS fragment sequences together with 12 nuclear microsatellites. These nuclear regions were selected based on their previously reported divergence between N. obliqua and N. alpina. The survey was conducted in 12 individuals from Lagunas de Epulauquen, and individuals from N. obliqua (8), N. alpina (1), N. macrocarpa (2), N. glauca (4) and N. leonii (2). By combining a phylogenetic analysis with a principal coordinate analysis of microsatellite data, we showed that Lagunas de Epulauquen individuals were closely related to other N. obliqua individuals, while hybridization with N. alpina was not detected. Our results indicate that hybridization processes could be discarded as the origin of the Lagunas de Epulauquen distinctiveness. The hypothesis of the convergence of two N. obliqua migratory routes at this latitude was reinforced based on detected patterns of genetic diversity. Notwithstanding, its high geographical isolation seems to be also a key evolutionary factor to explain the distinctiveness of this population. Lagunas de Epulauquen population could be therefore included within Argentinean N. obliqua domestication and conservation programs.

show abstract

Section: Introductionsupporting

confidence: 60%

Section: Introductionmentioning

confidence: 68%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionunclassified

See 3 more Smart Citations

Searching for molecular insight on hybridization in Nothofagus spp. forests at Lagunas de Epulauquen, Argentina

2016

View full text Add to dashboard Cite

show abstract

Population genetic structure, genetic diversity, and natural history of the South American species of Nothofagus subgenus Lophozonia (Nothofagaceae) inferred from nuclear microsatellite data

Vergara

Gitzendanner

Soltis

et al. 2014

Ecology and Evolution

View full text Add to dashboard Cite

The effect of glaciation on the levels and patterns of genetic variation has been well studied in the Northern Hemisphere. However, although glaciation has undoubtedly shaped the genetic structure of plants in the Southern Hemisphere, fewer studies have characterized the effect, and almost none of them using microsatellites. Particularly, complex patterns of genetic structure might be expected in areas such as the Andes, where both latitudinal and altitudinal glacial advance and retreat have molded modern plant communities. We therefore studied the population genetics of three closely related, hybridizing species of Nothofagus (N. obliqua, N. alpina, and N. glauca, all of subgenus Lophozonia; Nothofagaceae) from Chile. To estimate population genetic parameters and infer the influence of the last ice age on the spatial and genetic distribution of these species, we examined and analyzed genetic variability at seven polymorphic microsatellite DNA loci in 640 individuals from 40 populations covering most of the ranges of these species in Chile. Populations showed no significant inbreeding and exhibited relatively high levels of genetic diversity (HE = 0.502–0.662) and slight, but significant, genetic structure (RST = 8.7–16.0%). However, in N. obliqua, the small amount of genetic structure was spatially organized into three well-defined latitudinal groups. Our data may also suggest some introgression of N. alpina genes into N. obliqua in the northern populations. These results allowed us to reconstruct the influence of the last ice age on the genetic structure of these species, suggesting several centers of genetic diversity for N. obliqua and N. alpina, in agreement with the multiple refugia hypothesis.

show abstract

Genetic diversity of the rain tree (Albizia saman) in Colombian seasonally dry tropical forest for informing conservation and restoration interventions

Aguirre-Morales

Thomas²,

Cardozo

et al. 2020

Ecology and Evolution

View full text Add to dashboard Cite

Albizia saman is a multipurpose tree species of seasonally dry tropical forests (SDTFs) of Mesoamerica and northern South America typically cultivated in silvopastoral and other agroforestry systems around the world, a trend that is bound to increase in light of multimillion hectare commitments for forest and landscape restoration. The effective conservation and sustainable use of A. saman requires detailed knowledge of its genetic diversity across its native distribution range of which surprisingly little is known to date. We assessed the genetic diversity and structure of A.saman across twelve representative locations of SDTF in Colombia, and how they may have been shaped by past climatic changes and human influence. We found four different genetic groups which may be the result of differentiation due to isolation of populations in preglacial times. The current distribution and mixture of genetic groups across STDF fragments we observed might be the result of range expansion of SDTFs during the last glacial period followed by range contraction during the Holocene and human‐influenced movement of germplasm associated with cattle ranching. Despite the fragmented state of the presumed natural A. saman stands we sampled, we did not find any signs of inbreeding, suggesting that gene flow is not jeopardized in humanized landscapes. However, further research is needed to assess potential deleterious effects of fragmentation on progeny. Climate change is not expected to seriously threaten the in situ persistence of A. saman populations and might present opportunities for future range expansion. However, the sourcing of germplasm for tree planting activities needs to be aligned with the genetic affinity of reference populations across the distribution of Colombian SDTFs. We identify priority source populations for in situ conservation based on their high genetic diversity, lack or limited signs of admixture, and/or genetic uniqueness.

show abstract

Management of Nothofagus genetic resources: Definition of genetic zones based on a combination of nuclear and chloroplast marker data

Cited by 33 publications

References 56 publications

Searching for molecular insight on hybridization in Nothofagus spp. forests at Lagunas de Epulauquen, Argentina

Searching for molecular insight on hybridization in Nothofagus spp. forests at Lagunas de Epulauquen, Argentina

Population genetic structure, genetic diversity, and natural history of the South American species of Nothofagus subgenus Lophozonia (Nothofagaceae) inferred from nuclear microsatellite data

Genetic diversity of the rain tree (Albizia saman) in Colombian seasonally dry tropical forest for informing conservation and restoration interventions

Contact Info

Product

Resources

About