Manipulation of OCT4 Levels in Human Embryonic Stem Cells Results in Induction of Differential Cell Types

Abstract

To fully understand self-renewal and pluripotency and their regulation in human embryonic stem cells (hESCs), it is necessary to generate genetically modified cells and analyze the consequences of elevated and reduced expression of genes. Genes expressed in hESCs using plasmid vectors, however, are subject to silencing. Moreover, hESCs have a low plating efficiency when dissociated to single cells, making creation of subcloned lines inefficient. In addition to overexpression experiments, it is important to perform loss-of-function studies, which can be achieved rapidly using RNA interference (RNAi). We report stable long-term expression of enhanced green fluorescent protein (eGFP) in hESCs using a lentiviral vector, and establishment of an eGFP-expressing subline (RG6) using manual dissection. To demonstrate the efficacy of RNAi in hESCs, an RNAi expression vector was used to achieve reduced expression of eGFP in hESCs. To evaluate the role of OCT4 in the regulation of hESC self-renewal and differentiation, a vector expressing a hairpin RNA targeting endogenous expression of OCT4 was constructed. In a novel experiment in hESCs, the OCT4 cDNA sequence was cloned into an expression vector to allow for the transient upregulation of OCT4 in hESCs. The ability to manipulate levels of OCT4 above and below enodogenous levels allows the determination of OCT4 function in hESCs. Specifically, reduced expression of OCT4 in hESCs promoted upregulation of markers indicative of mesoderm and endoderm differentiation, and elevated levels of OCT4 in hESCs promoted upregulation of markers indicative of endoderm derivatives. Thus, both upregulation and downregulation of Oct4 in hESCs results in differentiation, but with patterns distinct from parallel experiments in mice.

Induced overexpression of OCT4A in human embryonic stem cells increases cloning efficiency

“…In contrast to other reports (13,20,32,45,46), a novel feature of our studies was the design and use of independent shRNA constructs specifically targeting the unique NH 2 -terminal domain of OCT4A, precluding the possibility of inadvertently knocking down the OCT4B splice variant, which shares 225 amino acids with OCT4A. Our results show that specific knockdown of OCT4A led to moderate upregulation of ectodermal genes, consistent with a recent study by Wang et al (41).…”

“…3B). Previous studies used RNA interference to reduce expression of OCT4 in hESC (3,13,20,32,45,46), but the targeted sequences were found in the COOH-terminal domain common to OCT4A and OCT4B (Fig. 3C), thereby preventing isoform-specific knockdown and potentially confounding results.…”

“…To further complicate the regulation of OCT4 and interpretation of human OCT4 studies, there are six transcribed pseudogenes for OCT4, with up to 95% homology to the endogenous gene (17,25). Functional RNA interference studies in hESC demonstrated that OCT4 downregulation leads to trophectoderm and endoderm differentiation (13,20,32,45,46). However, these studies targeted the COOH terminus, which is common to OCT4A and OCT4B.…”

Distinct activities of the anaphase-promoting complex/cyclosome (APC/C) in mouse embryonic cells

“…Silencing the expression of Emi1 in mouse pluripotent cells induces giant cell differentiation and upregulation induces trophectoderm differentiation, 7 in contrast to human ES cells, where loss of Oct4 induces differentiation toward mesoderm and endoderm. 35 Analogously, geminin-deficient mouse embryos, EC and ES cells result in trophoblast cell differentiation. Formation of a blastocoelic cavity in mouse embryos that lack geminin can only result from the functional Na + /K + pumps of trophoblast cells, which pump fluid toward the center of the hitherto embryonic mass known as the morula.…”

Growth and Differentiation Factor 3 Is Transcriptionally Regulated by OCT4 in Human Embryonic Carcinoma Cells

“…To prepare the short hairpin RNA (shRNA) expression vector for RNA interference of OCT4, two double-stranded oligonucleotides were generated, based on a previous report 32) for maximum silencing efficiency by annealing 5′-GAT CCGCGATCAAGCAGCGAC TATGAAGCTTGATAGTCGCTGCTTGATCGCTTT TTT GGA AGC-3′ (sense) and 5′-GGC CGC TTC CAA AAA AGC GATCAAGCAGCGACTATCAAGCTTCATAGTCGCTGC TTGATCGCG-3′ (antisense). The OCT4 sense and antisense sequences are underlined.…”