Mechanism of Feedback Allosteric Inhibition of ATP Phosphoribosyltransferase

Pedreño, Sònia; Pisco, João Pedro; Larrouy-Maumus, Gérald; Kelly, Geoff; Carvalho, Luiz Pedro S. de

doi:10.1021/bi300808b

Cited by 34 publications

(80 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…PaATPPRT followed Michaelis-Menten kinetics for both ATP ( Figure 3C) and PRPP ( Figure 3D). 3,4,14 The exception is LlATPPRT KM for ATP, which is 1.5-fold lower than that for PaATPPRT. 21 High KM is a common feature of cold-adapted enzymes.…”

Section: Cold-adaptations In Paatpprtmentioning

confidence: 81%

Kinetics and Structure of a Cold-Adapted Hetero-Octameric ATP Phosphoribosyltransferase

Stroek

Talbot²,

Glok³

et al. 2017

Biochemistry

112

View full text Add to dashboard Cite

ATP-phosphoribosyltransferase (ATPPRT) catalyses the first step in histidine biosynthesis, the condensation of ATP and 5-phospho--D-ribosyl-1-pyrophosphate to generate N 1 -(5-phospho--D-ribosyl)-ATP and inorganic pyrophosphate. The enzyme is allosterically inhibited by histidine. Two forms of ATPPRT, encoded by the hisG gene, exist in nature, depending on the species. The long form, HisGL, is a single polypeptide chain with catalytic and regulatory domains. The short form, HisGS, lacks a regulatory domain, and cannot bind histidine. HisGS instead is found in complex with a regulatory protein, HisZ, constituting the ATPPRT holoenzyme. HisZ triggers HisGS catalytic activity while rendering it sensitive to allosteric inhibition by histidine. Until recently, HisGS was thought to be catalytically inactive without HisZ. Here, recombinant HisGS and HisZ from the psychrophilic bacterium Psychrobacter arcticus were independently overexpressed and purified. The crystal structure of P. arcticus ATPPRT was solved at 2.34-Å resolution, revealing an equimolar HisGS-HisZ hetero-octamer. Steady-state kinetics indicate that both ATPPRT holoenzyme and HisGS are catalytically active. Surprisingly, HisZ confers only a modest 2-to 4-fold increase in kcat.Reaction profiles for both enzymes are indistinguishable by 31 P-NMR, indicating that the same reaction is catalysed. Temperature dependence of kcat shows deviation from Arrhenius behaviour at 308 K with the holoenzyme. Interestingly, such deviation is detected only at 313 K with HisGS. Thermal denaturation by CD spectroscopy resulted in Tm's of 312 K and 316 K for HisZ and HisGS, respectively, suggesting that HisZ renders the ATPPRT complex more thermolabile. This is the first characterisation of a psychrophilic ATPPRT. 4Adenosine 5ʹ-triphosphate phosphoribosyltransferase (ATPPRT) (EC 2.4.2.17) catalyses the reversible Mg 2+ -dependent reaction between adenosine 5ʹ-triphosphate (ATP) and(PR-ATP) and inorganic pyrophosphate (PPi) (Scheme 1), the first step in histidine biosynthesis. 1 The chemical equilibrium of the reaction strongly favours reactants, 2 and the enzyme is allosterically inhibited by histidine. 1 In addition to being a model for understanding allostery, 2-4 ATPPRT is of biotechnological interest as a tool for histidine production, provided that histidine feedback inhibition can be overcome. [5][6][7] Two forms of ATPPRT, encoded by the hisG gene, are found in nature. Fungi, plants, and most bacteria possess a long, homo-hexameric protein, HisGL, each subunit consisting of two domains that make up the catalytic core and a C-terminal regulatory domain that mediates feedback inhibition by histidine. 8 Some bacteria and archaea have a short version of the protein, HisGS, which lacks the C-terminal regulatory domain and is insensitive to histidine. In these organisms, a catalytically inactive regulatory protein, HisZ, the product of the hisZ gene, is present. 9 HisZ, which shares a common ancestry with histidyl-tRNA synthetase (HisRS), binds HisGS to form ...

show abstract

Section: Cold-adaptations In Paatpprtmentioning

confidence: 81%

Kinetics and Structure of a Cold-Adapted Hetero-Octameric ATP Phosphoribosyltransferase

Stroek

Talbot²,

Glok³

et al. 2017

Biochemistry

112

View full text Add to dashboard Cite

show abstract

Section: Cloning Of Llahisg S and Llahiszmentioning

confidence: 99%

“…LlahisG S was subcloned into pET-28a with an N-terminal (His) 6 -tag and pET-21a with no tag. LlahisZ was subcloned into pET-28a and MCSI of pRSFDuet-1, both with an N-terminal (His) 6 -tag. A three step thermocycling protocol was employed with a 60°C annealing temperature and a 30 s extension time as per the protocol for Phusion HF DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA).…”

Section: Cloning Of Llahisg S and Llahiszmentioning

confidence: 99%

“…The supernatant was applied to a 5 mL HisTrap IMAC column (GE Healthcare, Buckinghamshire, UK). The (His) 6 -tagged LlaHisG S eluted as a single peak with an imidazole gradient of 20-500 mM over ten column volumes. The fractions containing LlaHisG S were pooled and buffer exchanged into size exclusion chromatography (SEC) buffer (50 mM potassium phosphate, pH 7.5, 150 mM NaCl, 5 mM MgCl 2 , 200 lM TCEP) and loaded onto a Superdex 26/60 column (GE Healthcare).…”

Section: Purification Of Llahisg Smentioning

confidence: 99%

“…GGTGGTGGTGCTCGAGTCATCAGAATCGGCAGAACCTGAT a Note that the bold regions bind to the synthetic gene sequence, which in the case of (His) 6 -tagged proteins includes the TEV protease cleavage site.…”

Section: Saxs Data Collectionmentioning

confidence: 99%

See 2 more Smart Citations

Independent catalysis of the short form HisG from Lactococcus lactis

et al. 2016

View full text Add to dashboard Cite

Edited by Michael IbbaATP-phosphoribosyltransferase (ATP-PRT) catalyses the first step of histidine biosynthesis. Two different forms of ATP-PRT have been described; the homo-hexameric long form, and the hetero-octameric short form. Lactococcus lactis possesses the short form ATP-PRT comprising four subunits of HisG S , the catalytic subunit, and four subunits of HisZ, a histidyl-tRNA synthetase paralogue. Previous studies have suggested that HisG S requires HisZ for catalysis. Here, we reveal that the dimeric HisG S does display ATP-PRT activity in the absence of HisZ. This result reflects the evolutionary relationship between the long and short form ATP-PRT, which acquired allosteric inhibition and enhanced catalysis via two divergent strategies.

show abstract

Campylobacter jejuni adenosine triphosphate phosphoribosyltransferase is an active hexamer that is allosterically controlled by the twisting of a regulatory tail

et al. 2016

View full text Add to dashboard Cite

Adenosine triphosphate phosphoribosyltransferase (ATP-PRT) catalyzes the first committed step of the histidine biosynthesis in plants and microorganisms. Here, we present the functional and structural characterization of the ATP-PRT from the pathogenic e-proteobacteria Campylobacter jejuni (CjeATP-PRT). This enzyme is a member of the long form (HisG L ) ATP-PRT and is allosterically inhibited by histidine, which binds to a remote regulatory domain, and competitively inhibited by AMP. In the crystalline form, CjeATP-PRT was found to adopt two distinctly different hexameric conformations, with an open homohexameric structure observed in the presence of substrate ATP, and a more compact closed form present when inhibitor histidine is bound. CjeATP-PRT was observed to adopt only a hexameric quaternary structure in solution, contradicting previous hypotheses favoring an allosteric mechanism driven by an oligomer equilibrium.Abbreviations: ATP-PRT, adenosine triphosphate phosphoribosyltransferase; BTP, 1,3-bis[tris(hydroxymethyl)methylamino]propane; CjeATP-PRT, ATP-PRT from Campylobacter jejuni; EcoATP-PRT, Escherichia coli ATP-PRT; His, l-histidine; ITC, isothermal titration calorimetry; MtuATP-PRT, Mycobacterium tuberculosis ATP-PRT; PDB, Protein Data Bank; PR-ATP, phosphoribosyl ATP; PRPP, phosphoribosyl pyrophosphate; PRT, phosphoribosyltransferase; RMSD, root-mean-square difference; SenATP-PRT, Salmonella enterica subsp. enterica Typhimurium ATP-PRT Additional Supporting Information may be found in the online version of this article.Significance Statement: ATP-phosphoribosyltransferase catalyzes the first dedicated step in the biosynthesis of the essential amino acid histidine in microorganisms. We report the functional characterization of this enzyme from human pathogen Campylobacter jejuni. The enzyme is inhibited by histidine, allowing for tuned production of histidine in response to cellular demands. Our results reveal how the enzyme structure becomes compressed when histidine binds and exposes the molecular details of how this enzyme performs its function. Instead, this study supports the conclusion that the ATP-PRT long form hexamer is the active species; the tightening of this structure in response to remote histidine binding results in an inhibited enzyme.

show abstract

Mechanism of Feedback Allosteric Inhibition of ATP Phosphoribosyltransferase

Cited by 34 publications

References 44 publications

Kinetics and Structure of a Cold-Adapted Hetero-Octameric ATP Phosphoribosyltransferase

Kinetics and Structure of a Cold-Adapted Hetero-Octameric ATP Phosphoribosyltransferase

Independent catalysis of the short form HisG from Lactococcus lactis

Campylobacter jejuni adenosine triphosphate phosphoribosyltransferase is an active hexamer that is allosterically controlled by the twisting of a regulatory tail

Contact Info

Product

Resources

About