Mechanisms of Natural Gene Therapy in Dystrophic Epidermolysis Bullosa

Abstract

Revertant mosaicism has been reported in several inherited diseases, including the genetic skin fragility disorder epidermolysis bullosa (EB). Here, we describe the largest cohort of seven patients with revertant mosaicism and dystrophic EB (DEB), associated with mutations in the COL7A1 gene, and determine the underlying molecular mechanisms. We show that revertant mosaicism occurs both in autosomal dominantly and recessively inherited DEB. We found that null mutations resulting in complete loss of collagen VII and severe disease, as well as missense or splice-site mutations associated with some preserved collagen VII function and a milder phenotype, were corrected by revertant mosaicism. The mutation, subtype, and severity of the disease are thus not decisive for the presence of revertant mosaicism. Although collagen VII is synthesized and secreted by both keratinocytes and fibroblasts, evidence for reversion was only found in keratinocytes. The reversion mechanisms included back mutations/mitotic recombinations in 70% of the cases and second-site mutations affecting splicing in 30%. We conclude that revertant mosaicism is more common than previously assumed in patients with DEB, and our findings will have implications for future therapeutic strategies using the patient's naturally corrected cells as a source for cell-based therapies.

Blaschko line acne on pre-existent hypomelanosis reflecting a mosaicFGFR2mutation

“…We used LDM to better define the population of mutant cells. DNA was recovered from defined areas of the skin sections of our patient, and the region spanning the mutation was analysed by nested PCR and sequencing using previously described methods . The primers used were as follows: four forward GACAGCCCTCTGGACAACAC; four reverse CAAACCCATGAAGGAGACCC; four forward nested TCATTCTC CCATCCCCACTC; four reverse nested GCCCGTATTTACTGCCGTTC.…”

“…DNA was recovered from defined areas of the skin sections of our patient, and the region spanning the mutation was analysed by nested PCR and sequencing using previously described methods. 7 The primers used were as follows: four forward GACAGCCCTCTGGACAACAC; four reverse CAAACCCATGAAGGAGACCC; four forward nested TCATTCTC CCATCCCCACTC; four reverse nested GCCCGTATTTACT GCCGTTC. All PCRs were repeated with templates from at least three separate DNA isolations obtained by LDM, and without DNA as negative controls; all products were sequenced in both directions.…”

Epidermal aspects of type VII collagen: Implications for dystrophic epidermolysis bullosa and epidermolysis bullosa acquisita

“…Revertant mosaicism of EB skin was first reported in JEB and later in RDEB . Keratinocytes taken from an area of the skin where COL7A1 mutations were corrected by revertant mosaicism showed COL7 expression in vitro . Only one case of an autologous epidermal graft derived from EB revertant keratinocytes has been reported in the published work, and only a small amount of COL17 expression was observed in this COL17A1 ‐mutated JEB patient .…”

RNA‐based therapies for genodermatoses

“…Nevertheless, as the studies presented no clear evidence of wild‐type protein synthesis, the exact underlying mechanism remains elusive . The epidermis contains a pool of self‐renewing stem cells sufficient to sustain organ homeostasis, which is evident from long‐lasting mosaic patches that occur naturally in some genodermatoses . However, bone marrow transplantation, presently performed without further cell and niche manipulation, does not seem to substantially increase the number of curative stem cells in the epidermis and its long‐term potential is thus uncertain.…”