Mechanisms of radiation-induced gene responses

Abstract

Portions of this document m y be illegible in electronic image products. Images are produced from the best available original document. ABSTFUCTIn the process of identifying genes differentially expressed in cells exposed to ultraviolet CCJV) radiation; we identified a transcript having a 25-bp region that is highly conserved among a variety of species including Bacillus circuluns, pumpkin, yeast, Drosophila, mouse, and man: 5' AAGTGTTCTGCATAAGTGGCTTCC 3'. When in the 5' region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3' region (UTR), the sequence is most frequently in the -/+ orientatior? with respect to the coding DNA strand. In two genes, the element is split into two parts; however, in most cases. it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitosanase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to double-stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated an additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA in a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNX -repair process.

Metabolomic studies of radiation‐induced apoptosis of human leukocytes by capillary electrophoresis‐mass spectrometry and flow cytometry: Adaptive cellular responses to ionizing radiation

“…Similarly, whole body X‐ray radiation on mice pretreated with a priming dose has been reported to exhibit fewer instances of chromosomal damage that was associated with extended survival rates 19. In contrast, several studies have also demonstrated that low‐dose radiation (<0.1 Gy) can induce detrimental perturbations in normal cellular activity 20–24. For instance, Sakamoto‐Hojo et al 25 reported variations of gene expression in human leukocytes from health‐care workers from chronic exposure of low levels of IR using cDNA microarrays.…”