Melanoma dormancy in a mouse model is linked to GILZ/FOXO3A-dependent quiescence of disseminated stem-like cells

Abstract

Metastatic cancer relapses following the reactivation of dormant, disseminated tumour cells; however, the cells and factors involved in this reactivation are just beginning to be identified. Using an immunotherapy-based syngeneic model of melanoma dormancy and GFP-labelled dormant cell-derived cell lines, we determined that vaccination against melanoma prevented tumour growth but did not prevent tumour cell dissemination or eliminate all tumour cells. The persistent disseminated melanoma tumour cells were quiescent and asymptomatic for one year. The quiescence/activation of these cells in vitro and the dormancy of melanoma in vivo appeared to be regulated by glucocorticoid-induced leucine zipper (GILZ)-mediated immunosuppression. GILZ expression was low in dormant cell-derived cultures, and re-expression of GILZ inactivated FOXO3A and its downstream target, p21CIP1. The ability of dormancy-competent cells to re-enter the cell cycle increased after a second round of cellular dormancy in vivo in association with shortened tumour dormancy period and faster and more aggressive melanoma relapse. Our data indicate that future cancer treatments should be adjusted according to the stage of disease progression.

Novel Genetic Melanoma Vaccines Based on Induced Pluripotent Stem Cells or Melanosphere-Derived Stem-Like Cells Display High Efficacy in a murine Tumor Rejection Model

“…Moreover, the target cohorts of choice for cancer vaccination are patients with resected melanoma, who are immunized in the adjuvant setting. Recent animal studies [25] and our clinical observations (not published) suggest that cancer vaccination in the adjuvant setting does not prevent the systemic dissemination of cancer cells, but rather inhibits tumor formation by driving melanoma cells into dormancy.…”

“…Gene: Oct 3/4 (F: GAGGCTACAGGGACACCTTTC; R:GTGCCAAAGTGGGGACCT) (6), SSEA-1 (F: TGGTACTACGCGTGTTCGAC; R: CCAGGGCTTTGCCAGTTA) (32), NANOG (F:GCCTCCAGCAGATGCAAG; R: GGTTTTGAAACCAGGTCTTAACC) (25), and VEGFa (F: AAAAACGAAAGCGCAAGAAA; R: GGAACAAGTCTCGCCTCTTT) (1). Real-time PCR was performed using a Probes Master kit (Roche, Basel, Switzerland) on the LightCycler 480 (Roche, Basel, Switzerland).…”

A dual role for glucocorticoid-induced leucine zipper in glucocorticoid function: tumor growth promotion or suppression?

“…The role of GILZ has been studied in dormant cells of murine melanoma 111 . These are cells in mitotic reversible quiescence, present in cancer-treated and healthy individuals alike.…”

“…GILZ signaling, via the inhibition of FOXO3A and its downstream target, the cell cycle inhibitor, cyclin-dependent kinase inhibitor 1 (p21CIP1), antagonizes cell quiescence, induces cell cycle reactivation and tumor development in dormant murine melanoma cells. Furthermore, GILZ repression induces cellular quiescence, contributing to melanoma inactivity 111 (Fig. 4 ).…”

Cancer cell dormancy: mechanisms and implications of cancer recurrence and metastasis

“…And FOXO3A (one key substrate of PI3K/AKT pathway) is consequently diminished and p21 increased and eventually the cancer cell maintain dormancy. 62 Inhibiting AKT can trigger EGFR autophosphorylation, which also can lead to a growth arrest in cancer cells ( Table 1 ). 63 …”