Mesencephalic dopamine neurons regulate the expression of neuropeptide mRNAs in the rat forebrain.

Abstract

We used in situ hybridization histochemistry with synthetic oligodeoxyribonucleotide probes to identify cells that synthesize mRNAs encoding tyrosine hydroxylase in the mesencephalon and substance P, enkephalin, and dynorphin in the rat forebrain. Dopaminergic cells in the mesencephalon project to the forebrain and influence neuropeptide levels. We examined the effect of unilateral 6-hydroxydopamine lesions (which eliminated tyrosine hydroxylase mRNA-containing cells in the mesencephalon) on substance P, enkephalin, and dynorphin mRNA levels. Substance P mRNA levels were depressed, whereas enkephalin mRNA levels were elevated in consecutive sections from striatal areas in all animals. The effects of the lesions on dynorphin mRNA levels were less robust, and considerable variation between animals was observed. Changes were evident in the levels of message in individual cells but not in the numbers of labeled cells. These effects were not uniform throughout the dopamine-innervated areas, suggesting degrees of control not apparent with RNA blot-hybridization or dotblot analyses.Dopamine is a principal transmitter of the mesostriatal and mesocortical (or mesolimbic) components of the mesencephalic pathways to the forebrain (1), which exert major influences on an animal's behavior. In rats, lesions of these pathways may lead to behavioral deficits, such as akinesia, adipsia, and aphagia, while stimulation leads to increased motor activity and stereotyped behaviors such as sniffing, licking, and gnawing (2, 3). Side effects of neuroleptics such as acute dystonia and tardive dyskinesia and neurological diseases such as Parkinson's disease, in which a deficiency in mesostriatal dopamine is accompanied by movement disorders such as bradykinesia and tremor, demonstrate the importance of dopamine in human motor control (4).Undoubtedly, dopamine, in part, exerts its influence and is influenced in turn by neuropeptide transmitter systems. Extensive evidence exists for complex topographical relationships between these systems in the basal ganglia (5-9). Broadly, the caudate-putamen (CP) system receives input from the substantia nigra (SN) and ventral tegmental area (VTA), while the nucleus accumbens (NA) and olfactory tubercle (OT) are primarily innervated by the VTA. However, there is some overlap in the innervations of these striatal areas by the SN and VTA. Also, the dopamine cell group A8 projects to the NA and ventral CP. These dopamine-innervated areas contain substance P (SP) (10), enkephalin (Enk) (ref. 11 and references within), and dynorphin (Dyn) (12, 13) cell bodies, which project in characteristic ways out of the striatum. In the rat, SP (14-16) and Dyn (17) cells project principally to the SN, especially the pars reticulata, whereas Enk cells project to the globus pallidus (18-21).Changes in striatal neuropeptide biosynthesis result from lesioning mesencephalic dopamine neurons with 6-hydroxydopamine or chronic administration of neuroleptics. SP and SP mRNA levels in the striatum are depressed by neurole...

Localization of mRNAs encoding the α‐subunits of signal‐transducing G‐proteins within rat brain and among peripheral tissues

“…Our methods for in situ hybridization were similar to those developed for measurement of neuropeptide mRNA expression [29]. We have previously applied these methods to measurement of mRNAs encoding the a-subunit of transducin, the G-protein of photoreceptor rods [30,31].…”

“…(iii) The patterns of in situ hybridizations were compared with data which we have previously collected using similar methods to localize other mRNAs present in brain (i.e. neuropeptides [29]) and not present in brain (i.e. transducin and opsin [30,31]).…”

The Effect of Intrahippocampal Injection of Group II and III Metobotropic Glutamate Receptor Agonists on Anxiety; the Role of Neuropeptide Y

“…The sections were thaw mounted on chrome-alum-gelatine-coated microscopic slides and stored at À20 to 801C until in situ hybridization. The sections were then fixed in a 4% paraformaldehyde for 10 min and processed for in situ hybridization according to Young et al (1986), as described previously (Śmiałowska et al, 1999), and were hybridized with an NPY oligonucleotide probe (1 Â 10 6 c.p.m./100 ml) for 18 h at 421C in a humidified incubator. A 44 base synthetic deoxynucleotide (Genset-Oligo) with the sequence 5 0 TTGATGTAGTGT CGCAGAGCGGAGTAGTATCTGGCCATGTCCTC3 0 of rat NPYmRNA was used.…”

Gene Transcription Alterations Associated with Decrease of Ethanol Intake Induced by Naltrexone in the Brain of Wistar Rats

“…All these sections were obtained according to Paxinos and Franklin Atlas (Paxinos and Watson, 1986), mounted onto gelatin-coated slides and stored at À801C until the day of the assay. ISHH was performed as described previously (Young et al, 1986) using synthetic oligonucleotide probes complementary to TH mRNA (bases 1223-1252; Perkin Elmer, Pacisa-Giralt, Madrid, Spain), cannabinoid CB 1 -R mRNA Afigen, Madrid, Spain), CRF (bases 496-543; Perkin Elmer, Pacisa Giralt, Madrid, Spain), PENK (bases 388-435; Perkin Elmer, Pacisa-Giralt, Madrid, Spain), and 5-HTT (bases 77-126; Afigen, Madrid, Spain). Oligonucleotide probes were labeled using terminal deoxytransferase (Boehringer, Madrid, Spain) to add a 35 S-labeled deoxyATP (1000 Ci mmol À1 ; Amersham, Madrid, Spain) tail to the 3 0 end of the probes.…”