Mesenchymal stem cells increase hippocampal neurogenesis and counteract depressive-like behavior

Abstract

Adult bone marrow-derived mesenchymal stem cells (MSCs) are regarded as potential candidates for treatment of neurodegenerative disorders, because of their ability to promote neurogenesis. MSCs promote neurogenesis by differentiating into neural lineages as well as by expressing neurotrophic factors that enhance the survival and differentiation of neural progenitor cells. Depression has been associated with impaired neurogenesis in the hippocampus and dentate gyrus. Therefore, the aim of this study was to analyze the therapeutic potential of MSCs in the Flinders sensitive line (FSL), a rat animal model for depression. Rats received an intracerebroventricular injection of culture-expanded and 1,1 0 -dioctadecyl-3,3,3 0 ,3 0 -tetramethylindocarbocyanine perchlorate (DiI)-labeled bone marrow-derived MSCs (10 5 cells). MSC-transplanted FSL rats showed significant improvement in their behavioral performance, as measured by the forced swim test and the dominant-submissive relationship (DSR) paradigm. After transplantation, MSCs migrated mainly to the ipsilateral dentate gyrus, CA1 and CA3 regions of the hippocampus, and to a lesser extent to the thalamus, hypothalamus, cortex and contralateral hippocampus. Neurogenesis was increased in the ipsilateral dentate gyrus and hippocampus of engrafted rats (granular cell layer) and was correlated with MSC engraftment and behavioral performance. We therefore postulate that MSCs may serve as a novel modality for treating depressive disorders.

The Flinders Sensitive Line Rat Model of Depression—25 Years and Still Producing

“…For example, it was determined that deep brain stimulation had an AD-like effect in the FSL rat (Friedman et al, 2012). Earlier, they have shown that stem cell injections also had an AD-like effect (Tfilin et al, 2010). Through collaborators in England, Yadid has examined elevations in arachidonic acid in the FSL rats (Green et al, 2009).…”

Expression of Phospho-MeCP2s in the Developing Rat Brain and Function of Postnatal MeCP2 in Cerebellar Neural Cell Development

“…Quantitative PCR analysis was performed with Mastercycler Realplex (Eppendorf, Hamburg, Germany) using SYBR Green Realtime PCR Master Mix (Toyobo, Osaka, Japan). The primers were: Tuj1 forward, tagaccccagcggcaactat; Tuj1 reverse, gttccaggttccaagtccacc (PrimerBank); Dcx forward, ggggattgtgtacgctgttt; Dcx reverse, cgaccagttgggattgacat; Map-2 forward, caaacgtcattactttacaacttg; Map-2 reverse, cagctgcctctgtgagtgag; Gfap forward, ggtggagagggacaatctc; Gfap reverse, ccagctgctcctggagttct [26]; b-actin forward, gtcttcccctccatcgtggg; b-actin reverse, tggctggggtgttga aggtc.…”

Effects of Medium Supplements on Proliferation, Differentiation Potential, and In Vitro Expansion of Mesenchymal Stem Cells

“…Indeed, MSCs have been used for treatment of bone disorders such as in children with osteogenesis imperfecta, in whom allogeneic MSCs were engrafted and shown to enhance growth [2], repair of large defects in long bones when incorporated with biomaterial scaffolds [3], treatment of an atrophic tibial diaphyseal nonunion [4], reconstruction of a major maxillary defect, and reconstruction of jaw defects prior to dental implant placement [5,6]. Other promising clinical applications for MSCs come from their indirect immune-regulatory and paracrine action in a variety of clinical situations, such as reducing graftversus-host disease after hemopoietic stem cell (HSC) transplantation [7]; improving engraftment of HSCs [8]; and enhancing cardiac [9,10], liver [11], and neural repairs [12]. MSCs have been also used as vehicles for delivery of therapeutic gene products and agents to tumor and cancer sites [13].…”