Metabolic Activation of 4-Hydroxyanisole by Isolated Rat Hepatocytes

Abstract

This article is available online at http://dmd.aspetjournals.org ABSTRACT:A tyrosinase-directed therapeutic approach for treating malignant melanoma uses depigmenting phenolic prodrugs such as 4-hydroxyanisole (4-HA) for oxidation by melanoma tyrosinase to form cytotoxic o-quinones. However, in a recent clinical trial, both renal and hepatic toxicity were reported as side effects of 4-HA therapy. In the following, 4-HA (200 mg/kg i.p.) administered to mice caused a 7-fold increase in plasma transaminase toxicity, an indication of liver toxicity. Furthermore, 4-HA induced-cytotoxicity toward isolated hepatocytes was preceded by glutathione (GSH) depletion, which was prevented by cytochrome P450 inhibitors that also partly prevented cytotoxicity. The 4-HA metabolite formed by NADPH/microsomes and GSH was identified as a hydroquinone mono-glutathione conjugate. GSH-depleted hepatocytes were much more prone to cytotoxicity induced by 4-HA or its reactive metabolite hydroquinone (HQ). Dicumarol (an NAD(P)H/quinone oxidoreductase inhibitor) also potentiated 4-HA-or HQ-induced toxicity whereas sorbitol, an NADH-generating nutrient, prevented the cytotoxicity. Ethylenediamine (an o-quinone trap) did not prevent 4-HA-induced cytotoxicity, which suggests that the cytotoxicity was not caused by o-quinone as a result of 4-HA ring hydroxylation. Deferoxamine and the antioxidant pyrogallol/4-hydroxy-2,2,6,6-tetramethylpiperidene-1-oxyl (TEMPOL) did not prevent 4-HA-induced cytotoxicity, therefore excluding oxidative stress as a cytotoxic mechanism for 4-HA. A negligible amount of formaldehyde was formed when 4-HA was incubated with rat microsomal/ NADPH. These results suggest that the 4-HA cytotoxic mechanism involves alkylation of cellular proteins by 4-HA epoxide or p-quinone rather than involving oxidative stress.The incidence of malignant melanoma is increasing at an alarming rate among Caucasians (Albino and Fountain, 1993). The lack of effective antimelanoma drugs for treating this form of cancer is partly due to drug resistance (Nathanson and Jilani, 1993). Metastatic melanoma cells are pigmented because active tyrosinase of the melaninsynthesizing pathway is found in melanocytes (Riley, 1991). Thus, the unique ability of melanocytes to produce melanin pigment could be exploited in an enzyme directed melanoma therapy (Jimbow et al., 1993). The selective toxicity of phenolic antimelanoma agents toward local and metastatic melanoma cells could be achieved if the phenolic agent were bioactivated by melanoma tyrosinase to form reactive o-quinones as long as the agent was not bioactivated by hepatic or renal cytochrome P450. Several phenolic agents have been tested for their antimelanoma effect among which 4-hydroxyanisole (4-HA 1 ) had the greatest depigmenting ability. 4-HA was first shown by Riley (1969) to be a melanocytotoxic agent. Depigmentation and tumor shrinkage resulted from both the topical application of 4-HA (Riley, 1969) and intra-arterial infusions of 4-HA into the legs (Morgan, 1984). Unfortunately, 4-HA cl...

Efficacy of acetaminophen in skin B16-F0 melanoma tumor-bearing C57BL/6 mice

“…The RNAi insert sequences found in these plasmids were GTAGCCGATTGGAGGAGTACA, and CCAGAAGCTGACAGGAGATGA, and GACGACTCTTG GTGAGAAGAA, and TGAGCTTGCTGTGTCGTCACA and the non-specific scrambled sequence ggaatctcattcgatgc atac was used as a control. The tyrosinase-proficient SK-MEL-28 cells (2x10 6 ) were transfected with the 1 μg plasmid DNAs (of all shRNA clones) for 48 h using the FuGENE6 reagent (Roche Diagnostics Corporation, Indianapolis, IN). The cells were trypsinized, pelleted and washed twice with cold PBS.…”

“…Using this approach, 4-hydroxyanisole (4-HA) was investigated in melanoma clinical trials but was withdrawn due to liver and kidney toxicity (8). We have previously reported that 4-HA was also bioactivated by liver P450 enzymes to reactive oquinone, which contributed to its liver toxicity (6). Because drug metabolism, pharmacokinetics and drug induced liver and kidney toxicity continue to be major limiting factors in today's drug discovery endeavors, our efforts were directed towards optimizing lead phenolic-based prodrugs with selective efficacy towards melanoma but with minimal liver and kidney toxicity.…”

“…Tyrosinase has previously been used as a molecular target in melanoma-directed prodrug therapy (4)(5)(6)(7). Using this approach, 4-hydroxyanisole (4-HA) was investigated in melanoma clinical trials but was withdrawn due to liver and kidney toxicity (8).…”

Scientific Opinion on Flavouring Group Evaluation 22, Revision 1 (FGE.22Rev1): Ring‐substituted phenolic substances from chemical groups 21 and 25

“…The authors propose that ring epoxidation and/or P450-mediated one electron oxidation as bioactivation routes to convert 4-methoxyphenol to the reactive intermediate species, 4-hydroxyanisole epoxide and p-quinone, occurs rather than O-demethylation / ring hydroxylation / ipso attack mechanism. The cytotoxicity of 4-methoxyphenol results from covalent binding of hydroquinone / p-quinone to proteins rather than from oxidative stress (Moridani et al, 2002).…”

Opinion of the Scientific Panel on food additives, flavourings, processing aids and materials in contact with food (AFC) related to Flavouring Group Evaluation 22 (FGE.22): Ring‐substituted phenolic substances from chemical groups 21 and 25 (Commission Regulation (EC) No 1565/2000 of 18 July 2000)

“…The authors propose that ring epoxidation and/or P450-mediated one electron oxidation as bioactivation routes to convert 4-methoxyphenol to the reactive intermediate species, 4-hydroxyanisole epoxide and p-quinone, occurs rather than O-demethylation / ring hydroxylation / ipso attack mechanism. The cytotoxicity of 4-methoxy-phenol results from covalent binding of hydroquinone / p-quinone to proteins rather than from oxidative stress (Moridani et al, 2002).…”