Metagenomic 16S rRNA gene sequencing survey of Borrelia species in Irish samples of Ixodes ricinus ticks

Abstract

29 Lyme borreliosis is a systemic infection caused by tick-borne pathogenic borreliae of the 30 Borrelia burgdorferi sensu lato complex or of the more heterogeneous relapsing fever borrelia 31 group. Clinical distinction of the infections due to different borrelia species is difficult. Accurate 32 knowledge of the prevalence and the species of borreliae in the infected ticks in the endemic 33 areas is valuable for formulating appropriate guidelines for proper management of this infectious 34 disease. The purpose of this research was to design a readily implementable protocol to detect 35 the divergent species of borreliae known to exist in Europe, using Irish samples of Ixodes ricinus 36 64 manifestations resulting from host immune response to various spirochetal products or 65 components. However, if not treated early, within days to weeks, the borrelial spirochetes 66 disseminate from the site of the tick bite to other regions of the body [8]. 67Since Lyme borreliosis only occurs in the endemic areas where the tick population is infected 68 with pathogenic borrelial species, accurate surveys of the borrelial infections of the ticks 3 69 collected in the potential endemic areas can provide valuable information on the possible 70 existence of any of these Lyme and related borrelioses, and can serve as guidelines for selection 71 of the proper antigens for diagnostic serology tests which may be species-or even strain-specific 72 [9][10][11]. 73 In the past, the methods used for borrelial surveys were either designed to detect B. burgdorferi 74 sensu lato [1] or to detect B. miyamotoi [7, 12] in ticks; the PCR primers used for these 75 metagenomic assays were unable to amplify a conserved segment of DNA shared by all species 76 of borreliae. Only one study used a pair of general PCR primers which can amplify a segment of 77 16S rRNA gene of both B. burgdorferi sensu lato and B. miyamotoi for real-time PCR screening 78 [13]. But the interprimer DNA segment of the latter real-time PCR product is only 25 bp long 79 which is too short for automated Sanger sequencing that is required to confirm the molecular 80 diagnosis of B. miyamotoi [ 7, 12, 13]. In addition, the dye-labeled probe 6FAM-81 TTCGGTACTAACTTTTAGTTAA used for the real-time PCR screening [13] may miss the 82 species of B. valaisiana and B. lusitaniae whose corresponding complementary sequences in this 83 segment are TTAACTGAAAGTTAGTACCGAA (Sequence ID: NR_036807) and 84 TTAACTAACAGTTAGTACCGAA (Sequence ID: AB091822), respectively, not fully matched 85 with the sequence of the probe designed for other species of the B. burgdorferi sensu lato 86 complex. 87 In the current study, we used a pair of genus-specific PCR primers to amplify a highly conserved 88 segment with single-nucleotide polymorphisms of the borrelial 16S rRNA gene shared by all 89 known pathogenic borrelial strains to survey the borrelial infections among the I. ricinus ticks 90 collected in Ireland. Since this PCR amplicon is 357/358 bp long, the PCR products can be used 91 as the templa...