Metaphyseal chondrodysplasia McKusick type in a Chinese fetus, caused by novel compound heterozygosity 64T&gt; A and 79G &gt;T inRMRPgene

Lam, Albert; Chan, Daniel H C; Tong, Tony M F; Tang, Mónica; Lo, Steven Y. F.; Lo, Ivan F. M.; Lam, Stephen

doi:10.1002/pd.1547

Cited by 8 publications

(3 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The second category consists of mutations in the transcribed region and thus in the RNA molecule that is associated with the RMRP particle, because this RNA does not undergo post‐transcriptional processing 3. By now, more than 70 distinct mutations have been identified in the RMRP transcribed region of CHH patients, whereas 30 different CHH‐associated RMRP promoter mutations have been reported 3,19,78,80,83–85,92–102. All published CHH‐associated mutations and polymorphisms are listed in Tables 1 and 2, respectively.…”

Section: Chh‐associated Rmrp Mutationsmentioning

confidence: 99%

RNase MRP and disease

2010

View full text Add to dashboard Cite

The human RNase MRP complex consists of a catalytic RNA and several protein components. RNase MRP is a ubiquitously expressed eukaryotic endoribonuclease that cleaves various RNAs, including ribosomal, messenger, and mitochondrial RNAs, in a highly specific fashion. In several autoimmune diseases autoantibodies targeting RNase MRP have been found. These so-called anti-Th/To autoantibodies, which most frequently can be detected in the sera of scleroderma patients, are directed to several protein components of the RNase MRP and the evolutionarily related RNase P complex. It is not yet known whether the anti-Th/To immune response is an epiphenomenon or whether these autoantibodies play a role in the pathophysiology of the disease. The gene encoding the RNase MRP RNA was the first nuclear non-coding RNA gene demonstrated to be associated with a genetic disease. Mutations in this gene are causing the highly pleiotropic disease cartilage-hair hypoplasia (CHH). CHH patients are characterized by a short stature, hypoplastic hair, and short limbs. In addition, they show a predisposition to lymphomas and other cancers and suffer from defective T-cell immunity. Since the identification of the first CHH-associated mutations in 2001, many distinct mutations have been found in different patients. These mutations either affect the structure of the RNase MRP RNA or are located in the promoter region and reduce the expression levels. In this review article we will, after describing the biochemical aspects of RNase MRP, discuss the targeting of RNase MRP in autoimmunity and the role of mutations in the RNase MRP RNA gene in CHH.

show abstract

Section: Chh‐associated Rmrp Mutationsmentioning

confidence: 99%

RNase MRP and disease

2010

View full text Add to dashboard Cite

show abstract

“…Apart from the founder mutation g.70ArG, which is present in 92% of Finnish and 48% of non-Finnish patients with CHH, a total of 25 insertions or duplications between the TATA box and the transcription start site and 162 other mutations within the RMRP gene have been identified in patients with phenotypes in the CHH-AD spectrum (table 1). 1,3,[7][8][9][10][11][12][13][14][15][16] We recently showed the first evidence of a genotype-phenotype correlation by demonstrating that the CHH founder mutation affects ribosome assembly and cell-cycle regulation intermediately, whereas AD mutations severely affect ribosomal assembly only. 1 To further investigate genotype-phenotype correlations, we now analyze the functional effect of 13 mutations in pa- Ϫ26_Ϫ5dupTACTACTCTGTGAAGCTGAGAA 7 American g.…”

mentioning

confidence: 99%

“…Ϫ4_6insGGACGTGGTT 8 American g.4CrT 3,8,13 English, German, Spanish g.9TrC 7 German g.14GrT 7 American g.14GrA 1 German g.35CrT 3 French g.40GrA 3 Dutch g.45_53dupTGTTCCTCC 3 Dutch g.57_64insTTCCGCCT 8 French g.63CrT 3,8,14 Australian, Dutch g.64TrC 3 Italian g.64TrA 15 Chinese g.70ArG 3,[7][8][9]12 Various a g.79GrA 8 American g.79GrT 15 Chinese g.80GrA 7 American g.89CrG 7 American g.90_91AGrGC 1 German g.91GrA 7 Belgium g.93GrC 3 Dutch g.92_93insA 3 Turkish g.94_95delAG 8,16 Amish, English g.97GrA 3,7 American g.96_97dupTG 3,8,9 Canadian, Turkish g.101CrT 7 Belgium g.111_112insACTGTAGACATTCCT 1 Jordanian g.116ArG 7 American g.118ArG 8 German g.124CrT 7 American g.126CrT 3,8 Arabian, Italian g.127GrA 3 Italian, Canadian g.146GrA 3,8 Chinese, French g.146GrC 3 Italian g.152...…”

mentioning

confidence: 99%

Type and Level of RMRP Functional Impairment Predicts Phenotype in the Cartilage Hair Hypoplasia–Anauxetic Dysplasia Spectrum

Thiel

Mortier

Kaitila

et al. 2007

The American Journal of Human Genetics

View full text Add to dashboard Cite

Mutations in the RMRP gene lead to a wide spectrum of autosomal recessive skeletal dysplasias, ranging from the milder phenotypes metaphyseal dysplasia without hypotrichosis and cartilage hair hypoplasia (CHH) to the severe anauxetic dysplasia (AD). This clinical spectrum includes different degrees of short stature, hair hypoplasia, defective erythrogenesis, and immunodeficiency. The RMRP gene encodes the untranslated RNA component of the mitochondrial RNA-processing ribonuclease, RNase MRP. We recently demonstrated that mutations may affect both messenger RNA (mRNA) and ribosomal RNA (rRNA) cleavage and thus cell-cycle regulation and protein synthesis. To investigate the genotype-phenotype correlation, we analyzed the position and the functional effect of 13 mutations in patients with variable features of the CHH-AD spectrum. Those at the end of the spectrum include a novel patient with anauxetic dysplasia who was compound heterozygous for the null mutation g.254_263delCTCAGCGCGG and the mutation g.195C-->T, which was previously described in patients with milder phenotypes. Mapping of nucleotide conservation to the two-dimensional structure of the RMRP gene revealed that disease-causing mutations either affect evolutionarily conserved nucleotides or are likely to alter secondary structure through mispairing in stem regions. In vitro testing of RNase MRP multiprotein-specific mRNA and rRNA cleavage of different mutations revealed a strong correlation between the decrease in rRNA cleavage in ribosomal assembly and the degree of bone dysplasia, whereas reduced mRNA cleavage, and thus cell-cycle impairment, predicts the presence of hair hypoplasia, immunodeficiency, and hematological abnormalities and thus increased cancer risk.

show abstract

Molecular Genetics and Prenatal Diagnosis

Phillips

2009

Genetic Disorders and the Fetus

View full text Add to dashboard Cite

Metaphyseal chondrodysplasia McKusick type in a Chinese fetus, caused by novel compound heterozygosity 64T> A and 79G >T inRMRPgene

Cited by 8 publications

References 9 publications

RNase MRP and disease

RNase MRP and disease

Type and Level of RMRP Functional Impairment Predicts Phenotype in the Cartilage Hair Hypoplasia–Anauxetic Dysplasia Spectrum

Molecular Genetics and Prenatal Diagnosis

Contact Info

Product

Resources

About