Methane Mitigation and Microbial Diversity of Silage Diets Containing Calliandra calothyrsus in a Rumen in Vitro Fermentation System

Abstract

This study was conducted to investigate the effects of silage based diets on methane (CH 4) mitigation and microbial diversity in a rumen in vitro fermentation. The experiment was arranged in a completely randomized design with five treatments and three replications. The dietary treatments consisted of varying levels of silage containing 50% Calliandra calothyrsus as follows K; 100% concentrate + pure tannic acid of 1 mg/mL, R1; 25% silage + 75% concentrate, R2; 50% silage + 50% concentrate, R3; 75% silage + 25% concentrate, and R4; 100% silage. The fermentation variables measured were total gas, CH 4 , in vitro organic matter digestibility (IVOMD), VFAs, pH, N-NH 3 , number of protozoa, and microbial diversity analysis. Increasing level of silages reduced total gas production, CH 4 concentration, IVOMD, index of bacterial diversity, protozoal number, total methanogens and Methanobacteriales population. Diet with 25% to 50% silage decreased CH 4 concentration, total gas production and IVOMD by 11.43%, 24.92%, and 18.73%, respectively. Ammonia N and VFAs (except butyrate and valerate) were significantly reduced (P<0.01) by increasing level of silages in the ration. In conclusion, this study confirmed that 50% silage containing C. calothyrsus was efficient in mitigation of enteric CH 4 production by reducing total methanogens and Methanobacteriales number, but had negative effect on decreasing bacterial diversity and organic matter digestibility.

Untitled

“…Hal ini disebabkan dengan penambahan legum yang berbeda dapat meningkatkan kadar tanin dalam ransum (Tabel 3), tanin dapat menghambat aktivitas mikrob rumen dalam mencerna bahan pakan sehingga menyebabkan terjadi penurunan kecernaan bahan kering dan bahan organik ransum seiring dengan penambahan jenis legum. Keberadaaan tanin dapat mengurangi produksi gas dalam sistem fermentasi in vitro karena interaksi tanin dengan komponen-komponen pakan yang berkontribusi terhadap produksi gas, khususnya protein dan serat (Makkar et al, 2007;Ridwan et al, 2014). Nilai kecernaan bahan kering selaras dengan kecernaan bahan organik, nilai kecernaan bahan kering pada penelitian ini lebih tinggi dari kecernaan bahan organik hal ini dipengaruhi oleh kandungan bahan anorganik atau abu (Fathul dan Wajizah, 2010).…”

Bacteria and methanogen community in the rumen fed different levels of grass-legume silages

“…Samples of rumen fluid were mixed, homogenized, filtered by using sterilized double cheesecloth, and transferred to a sterilized corning tube. Microbial DNA from the rumen fluid of each treatment was extracted by using a Genomic DNA Mini Kit based on Buffy Coat Protocol (Geneaid) with some modifications (Ridwan et al 2014(Ridwan et al , 2015. The DNA from each treatment was pooled from 3 DNA samples collected.…”

“…The 16S rDNA amplification was performed as described previously by Ridwan et al (2014Ridwan et al ( , 2015. DNA was amplified by using primers 6FAM-27F (5'AGAGTTTGATCCTGGCTCAG3') and 1492R (5'GGTTACCTTGTTACGACTT3') for bacteria and 6FAM-Met86F…”

“…T-RFLP analysis was performed as described previously by Ridwan et al (2014Ridwan et al ( , 2015 based on the method of Sakamoto et al (2006) and Danielsson et al (2012), with some modification. The conditions of 16S rDNA amplification were described above.…”

“…Since crude protein supplies total N for microbes to synthesize protein, polyphenolics are a useful nutritional strategy to reduces CH4 emissions (Lopez et al 2010). The increased level of silage diets in a rumen in vitro fermentation system suppressed both methane production and protozoa population (Ridwan et al 2014). The combination of grasses and legumes (1:1) is an alternative solution for improving the crude protein content of feed for sustainable ruminant production (Ridwan et al 2015).…”