Methylation-associated silencing of BASP1 contributes to leukemogenesis in t(8;21) acute myeloid leukemia

Zhou, Lei; Fu, Lin; Lv, Na; Liu, Jing; Li, Yan; Chen, Xiaosu; Xu, Qingyu; Chen, Guofeng; Pang, Baoxu; Wang, Lili; Li, Yonghui; Zhang, Xiaodong; Yu, Li

doi:10.1038/s12276-018-0067-4

Cited by 34 publications

(35 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The BASP1 gene is downregulated in most mammalian cancers, and tumor‐suppressive functions of BASP1 were observed in several human cancer models (Guo et al , ; Marsh et al , ; Zhang et al , ; Zhou et al , ; Zhou et al , ). This corroborates our original finding that BASP1 strongly interferes with v‐Myc‐induced oncogenicity and displays properties of a tumor suppressor (Hartl et al , ).…”

Section: Discussionmentioning

confidence: 99%

“…This corroborates our original finding that BASP1 strongly interferes with v‐Myc‐induced oncogenicity and displays properties of a tumor suppressor (Hartl et al , ). In multiple carcinoma, melanoma, and leukemia cells, BASP1 transcription is silenced by promoter methylation (Kaehler et al , ; Moribe et al , ; Zhou et al , ), a typical DNA modification in the regulatory regions of tumor suppressors in cancer. An important function of BASP1 is to act as a transcriptional cosuppressor of the Wilms’ tumor suppressor protein WT1, converting the WT1 oncoprotein into a tumor suppressor (Carpenter et al , ; Goodfellow et al , ; Toska et al , ; Toska et al , ).…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

The brain acid‐soluble protein 1 (BASP1) interferes with the oncogenic capacity of MYC and its binding to calmodulin

et al. 2020

View full text Add to dashboard Cite

The MYC protein is a transcription factor with oncogenic potential controlling fundamental cellular processes such as cell proliferation, metabolism, differentiation, and apoptosis. The MYC gene is a major cancer driver, and elevated MYC protein levels are a hallmark of most human cancers. We have previously shown that the brain acid‐soluble protein 1 gene (BASP1) is specifically downregulated by the v‐myc oncogene and that ectopic BASP1 expression inhibits v‐myc‐induced cell transformation. The 11‐amino acid effector domain of the BASP1 protein interacts with the calcium sensor calmodulin (CaM) and is mainly responsible for this inhibitory function. We also reported recently that CaM interacts with all MYC variant proteins and that ectopic CaM increases the transactivation and transformation potential of the v‐Myc protein. Here, we show that the presence of excess BASP1 or of a synthetic BASP1 effector domain peptide leads to displacement of v‐Myc from CaM. The protein stability of v‐Myc is decreased in cells co‐expressing v‐Myc and BASP1, which may account for the inhibition of v‐Myc. Furthermore, suppression of v‐Myc‐triggered transcriptional activation and cell transformation is compensated by ectopic CaM, suggesting that BASP1‐mediated withdrawal of CaM from v‐Myc is a crucial event in the inhibition. In view of the tumor‐suppressive role of BASP1 which was recently also reported for human cancer, small compounds or peptides based on the BASP1 effector domain could be used in drug development strategies aimed at tumors with high MYC expression.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

The brain acid‐soluble protein 1 (BASP1) interferes with the oncogenic capacity of MYC and its binding to calmodulin

et al. 2020

View full text Add to dashboard Cite

show abstract

“…Among the genes that were found to be upregulated, Brain acid-soluble protein 1 (BASP1) was initially identified as an abundant membrane-bound protein in the brain. Accumulating evidence suggests BASP1 may have roles in neuronal plasticity and axon regeneration [29][30][31], as well as roles in apoptosis, differentiation, and transcriptional regulation [32,33]. CCAAT enhancer binding protein beta (CEBPB) has been identified as an epigenetic regulator of a mesenchymal signature.…”

Section: Discussionmentioning

confidence: 99%

Weighted gene co-expression network analysis identified six hub genes associated with rupture of intracranial aneurysms

et al. 2020

View full text Add to dashboard Cite

Intracranial aneurysms (IAs) are characterized by localized dilation or ballooning of a cerebral artery. When IAs rupture, blood leaks into the space around the brain to create a subarachnoid hemorrhage. The latter is associated with a higher risk of disability and mortality. The aims of this study were to gain greater insight into the pathogenesis of ruptured IAs, and to clarify whether identified hub genes represent potential biological markers for assessing the likelihood of IA progression and rupture. Briefly, the GSE36791 and GSE73378 datasets from the National Center of Biotechnology Information Gene Expression Omnibus database were reanalyzed and subjected to a weighted gene co-expression network analysis to test the association between gene sets and clinical features. The clinical significance of these genes as potential biomarkers was also examined, with their expression validated by quantitative real-time PCR. A total of 14 co-expression modules and 238 hub genes were identified. In particular, three modules (labeled turquoise, blue, and brown) were found to highly correlate with IA rupture events. Additionally, six potential biomarkers were identified (BASP1, CEBPB, ECHDC2, GZMK, KLHL3, and SLC2A3), which are strongly associated with the progression and rupture of IAs. Taken together, these findings provide novel insights into potential molecular mechanisms responsible for IAs and they highlight the potential for these particular genes to serve as biomarkers for monitoring IA rupture.

show abstract

“…To knock down AML1-ETO, the expression of AML1-ETO was silenced using a siRNA sequence directed against the AML1-ETO mRNA fusion site (siA/E-RNA) with reference to published literature. 12 For shRNA-mediated knockdown of SETDB2 gene, 1×10 6 Kasumi-1 cells or SKNO-1 cells were seeded in 6-well plates to a 80% confluence, and then transfected with shRNA lentivirus. The shRNA sequence used in this study (shRNA1#, CCGGTCTGACGTGGATATTAGTAA TCTCGAGATTACTAATATCCACGTCAGATTTTTG; sh RNA2#, CCGGCCAAGCAATGAATCTAGTAAACTCG AGTTTACTAGATTCATTGCTTGGTTTTTG) was synthesized by GenePharma (Shanghai, China) and packaged into hU6-MCS-PGK-EGFP lentiviral vector (GenePharma, Shanghai, China).…”

Section: Cell Transfectionmentioning

confidence: 99%

“…3 Abnormal distribution of promoter DNA methylation of multiple genes has been found in t(8; 21) AML, such as THAP domain-containing protein 10 (THAP10) and brain acid soluble protein 1 (BASP1). [4][5][6] However, the leukemogenic mechanism of t(8; 21) AML is not yet clear.…”

Section: Introductionmentioning

confidence: 99%

<p>Oncogenic Roles Of A Histone Methyltransferase SETDB2 In AML1-ETO Positive AML</p>

Chen

2020

CMAR

View full text Add to dashboard Cite

Introduction: AML1-ETO produced by t(8;21) abnomality has multiple effects on the leukemogenesis of acute myeloid leukemia (AML). SET domain, bifurcated 2 (SETDB2) can mediate gene silencing by trimethylation of the ninth lysine residue of histone H3 protein (H3K9) of the promoter and has been confirmed as an oncogene in many cancers. The role of SETDB2 in AML1-ETO positive AML is not clear. Methods: Quantitative reverse transcription PCR was performed to measure SETDB2 expression in bone marrow from AML patients and healthy people. Kaplan-Meier analysis was performed to investigate the effect of SETDB2 on prognosis of AML patients. Dual luciferase reporter gene assay, chromatin immunoprecipitation were performed to investigate the regulatory mechanism of AML1-ETO on SETDB2. CCK-8 and colony formation assay were performed to measure the effect of SETDB2 on leukemic cells. Results: SETDB2 is highly expressed in AML1-ETO positive AML. The overall survival, event-free and relapse-free survival rate of patients with high SETDB2 expression was lower than those of patients with low SETDB2 expression. SETDB2 is epigenetically upregulated by AML1-ETO fusion protein. Downregulation of SETDB2 expression significantly inhibits the proliferation and clonality of leukemic cells and promotes the sensitivity of leukemic cells to an epigenetic inhibitor JQ1. Conclusion: AML1-ETO/SETDB2 is a novel epigenetic pathway of leukemogenesis and SETDB2 is a potential therapeutic target of t(8;21) AML.

show abstract

Methylation-associated silencing of BASP1 contributes to leukemogenesis in t(8;21) acute myeloid leukemia

Cited by 34 publications

References 31 publications

The brain acid‐soluble protein 1 (BASP1) interferes with the oncogenic capacity of MYC and its binding to calmodulin

The brain acid‐soluble protein 1 (BASP1) interferes with the oncogenic capacity of MYC and its binding to calmodulin

Weighted gene co-expression network analysis identified six hub genes associated with rupture of intracranial aneurysms

<p>Oncogenic Roles Of A Histone Methyltransferase SETDB2 In AML1-ETO Positive AML</p>

Contact Info

Product

Resources

About