Microbial diversity in tanning wastewaters treatment reactors

Abstract

Diversity of the microbial consortia involved in biodegradation of unhairing wastewater from tanneries was assessed. Both culture‐dependent and culture‐independent approaches were applied to identify bacteria in the activated sludge and endogenous biomass systems. Conventional culturing using dilution and planting techniques yielded eighteen pure bacterial isolates from endogenous biomass and activated sludge reactors. Isolates were identified using sequence analysis of PCR‐amplified 16S rRNA sequences. Most of these bacteria belonged to the genus Bacillus. Culture‐independent molecular studies of bacterial diversity in both reactors, however, revealed a wide diversity of microorganisms, including members of the Proteobacteria group. Therefore, the alpha Proteobacteria group in the endogenous biomass was characterized by the genus Pseudochrobactrum, which was absent from the activated sludge biomass. The 77 and 88 bacterial clone sequences recovered from the activated sludge reactor and the endogenous biomass reactor, respectively, were grouped into 23 Operational Taxonomic Units (OTUs). The Proteobacteria division represented the predominant phylogenetic group within the clone library, encompassing 52.17% and 60.75% of the total OTUs obtained from the activated sludge and endogenous biomass tanks, respectively. The diversity in both tanks was also determined. The rarefaction curves and Shannon index indicated that bacterial populations were equally diverse in both reactors. © 2014 American Institute of Chemical Engineers Environ Prog, 34: 401–410, 2015

Improvement of Medicago sativa Crops Productivity by the Co-inoculation of Sinorhizobium meliloti–Actinobacteria Under Salt Stress

“…Bacterial genomic DNA was extracted by a CTAB–SDS lysis protocol [ 1 ]. PCR amplification of the 16S-rRNA gene was performed using the universal primers 27 F (5′-AGAGTTTGATCMTGGCTCAG-3′) and 1496R (5′-CTACGGCTACCTTGTTACGA-3′) [ 26 ]. PCR mixture, amplification conditions and PCR products sequencing were conducted according to Prospero et al [ 2 ].…”

“…Partial 16S-rRNA sequences of the isolates were compared with available sequences in the National Centre for Biotechnology Information (NCBI) database ( http://www.ncbi.nlm.nih.gov ) by BLAST search. Actinobacterial 16S-rDNA sequence alignment and phylogenetic analysis were performed using standard procedures detailed in Mlaik et al [ 26 ].…”

Durum Wheat Stress Tolerance Induced by Endophyte Pantoea agglomerans with Genes Contributing to Plant Functions and Secondary Metabolite Arsenal

“…DNA extraction, PCR amplification, and molecular identification of bacterial isolates was performed according to Mlaik et al [69]. Primers, fD1 (5′ AGAGTTTGATCCTGGCTCAG 3′) and rP2 (5′ ACGGCTACCTTGTTACGACTT 3′) [70] were used in the study.…”

Screening for Fusarium Antagonistic Bacteria From Contrasting Niches Designated the Endophyte Bacillus halotolerans as Plant Warden Against Fusarium

“…Qubit Fluorometric Quantitation (Thermo Fisher, Switzerland) was used to quantify genomic DNA, while DNA integrity and quality were assessed by visual inspection through 1.5% agarose gel electrophoresis. Molecular identification of the isolates was performed through amplification of the 16S rRNA region using primers fD1 (5′ AGAGTTTGATCCTGGCTCAG 3′) and rP2 (5′ ACGGCTACCTTGTTACGACTT 3′) (Weisburg et al, 1991; Mlaik et al, 2015). PCR amplifications were carried out in a total volume of 50 μL, containing 5 μL 10× Ex Taq buffer (20 mM Tris–HCl, pH 8.0, 100 mM KCl), 4 μL 2.5 mM dNTP mixture, 0.5 μM of each primer, 1.25 units Taq DNA polymerase (Takara Bio, Ohtsu, Japan) and 10 ng genomic DNA.…”