Microevolutionary analyses of Pythium insidiosum isolates of Brazil and Thailand based on exo-1,3-β-glucanase gene

Abstract

Pythium insidiosum is an important oomycete due to its ability to infect humans and animals. It causes pythiosis, a disease of difficult treatment that occurs more frequently in humans in Thailand and in horses in Brazil. Since cell-wall components are frequently related to host shifts, we decided here to use sequences from the exo-1,3-β-glucanase gene (exo1), which encodes an immunodominant protein putatively involved in cell wall remodeling, to investigate the microevolutionary relationships of Brazilian and Thai isolates of P. insidiosum. After neutrality ratification, the phylogenetic analyses performed through Maximum parsimony (MP), Neighbor-joining (NJ), Maximum likelihood (ML), and Bayesian analysis (BA) strongly supported Thai isolates being paraphyletic in relation to those from Brazil. The structure recovered by these analyses, as well as by Spatial Analysis of Molecular Variance (SAMOVA), suggests the subdivision of P. insidiosum into three clades or population groups, which are able to explain almost 81% of the variation encountered for exo1. Moreover, the two identified Thai clades were almost as strongly differentiated between each other, as they were from the Brazilian clade, suggesting an ancient Asian subdivision. The derived positioning in the phylogenetic tree, linked to the lower diversity values and the recent expansion signs detected for the Brazilian clade, further support this clade as derived in relation to the Asian populations. Thus, although some patterns presented here are compatible with those recovered with different molecular markers, exo1 was revealed to be a good marker for studying evolution in Pythium, providing robust and strongly supported results with regard to the patterns of origin and diversification of P. insidiosum.

New insights on evolutionary aspects of Pythium insidiosum and other peronosporaleans

“…After confirming the identity of each sequence by BLAST, these were aligned using the Clustal W algorithm, as implemented in Mega 6 . Additional sequences of P insidiosum previously characterised by Azevedo et al and Ribeiro et al were downloaded from GenBank. Complete information about these and the newly obtained P insidiosum sequences is shown in Table , which presents GenBank accession numbers from all the sequences.…”

“…The polymerase chain reaction (PCR) primers for amplification of a fragment of pf16 were designed using the nucleotide sequence , downloaded from GenBank (http://www.ncbi.nlm.-nih.gov/genbank), in Primer‐Blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/), which led to the following sequences: PF16F (5′‐GCAGCTCGTGTACTCGCTTT‐3′) and PF16R (5′‐ACTTCTGCACTTTCATCGGC‐3′). The amplification of the genetic markers ITS, cox2 and exo‐1 was performed using, respectively, ITS1 (5′‐GTAGTCATATGCTTGTCTC‐3′) and ITS4 (5′‐CTTCCGTCAATTCCTTTAAG‐3′) FM66 (5′‐TAGGATTTCAAGATCCTGC‐3′) and FM58 (5′‐CCACAAATTTCACTACATTGA‐3′), and P24F (5′‐ACACGTCGATCAACTACGGTAACC‐3′) and P24R (5′‐TTTGCTTGACGTTGGAGCAGTC‐3′) …”

“…The reactions were performed in a final volume of 25 μL containing 20 pmol of each primer, 1.5 units of Taq DNA Polymerase (Invitrogen), 200 μmol/L of each deoxynucleotide, 1.5 mmol/L MgCl 2 , 1× of the 10× enzyme buffer and 200 ng of DNA. The conditions of PCR reactions were previously described by Azevedo et al for cox 2 and ITS and by Ribeiro et al for exo‐1 . The PCR cycling conditions for pf16 gene were as follows: 94°C/3 min; 30 cycles of 94°C/45 s, 65°C/30 s, and 72°C/30 s; 72°C/10 min; and 4°C/∞.…”

“…Nevertheless, to date, most of these studies were performed using a limited set of traditional genetic markers, such as nuclear ribosomal DNA and/or mitochondrial markers . More recently other genetic markers have been studied, including some protein‐coding flagellar and immunodominant cell wall remodelling genes (like the central pair‐associated protein ( pf16 ), tubular mastigoneme protein ( ocm1 ) and exo‐1,3‐β‐glucanase ( exo‐1 )), and these genes have clarified several previously unanswered questions about origin and diversification of Pythium insidiosum …”

“…Pythium insidiosum is the causative agent of a life‐threatening infectious disease in animals and humans called pythiosis. Elucidating aspects related to the evolution, biology and pathogenesis of P insidiosum is thus required not only for understanding the disease but also for the development of an efficient method for its treatment and/or control …”