Mining activities accelerate the decomposition of organic matter from aquatic ecosystems through soil microbes

Abstract

Mining activities have been shown to affect the rate of carbon decomposition in aquatic ecosystems by altering the traits of the organic matter (e.g., leaf litter). However, the ecological function of soil microbes that enter aquatic ecosystems in association with organic matter is not known. Here, standardized cotton strip assays (CSA) were used to quantify the effects of soil microbial colonization location (mine vs. forest riverbank) and time (7 days vs. 14 days) on cellulose decomposition in aquatic ecosystems. The CSA results showed that the mine riverbank location and microbial colonization time had significant effects on the microbial community structure, microbial biomass, and functional genes of cellulose decomposition. Compared with the forest riparian zone, the fungal biomass and bacterial cellulose‐decomposing gene (GH48) abundance of cotton strips colonized in the mine riparian zone for 14 days were 12.5‐times and 54.93‐times higher than that of the cotton strips colonized in the forest riparian zone, respectively, while the fungal cellulose‐decomposing gene (cbhI) was detected only after 14 days of colonization. After 90 days of stream incubation, the decomposition rate and GH48 gene abundance of cotton strips colonized in the mine riparian zone for 14 days were significantly higher than those of cotton strips colonized in the forest riparian zone. However, the abundance of the cbhI gene in cotton strips colonized for 14 days was significantly higher than that in cotton strips colonized for 7 days. These results show that bacteria were mainly affected by the microbial colonization environment, while fungi were mainly affected by colonization time. Mining activities accelerate the decomposition of organic matter in aquatic ecosystems by increasing soil fungal biomass and bacterial cellulose decomposition genes. To reduce the carbon loss of aquatic ecosystems, it is necessary to study the potential influence of soil microbes on the decomposition of organic carbon in riparian zones.

Response of soil microorganisms to soil fertility in the process of vegetation rehabilitation of degraded Pinus massoniana forest

“…After vegetation rehabilitation and management, the soil bacterial community structure of the degraded P. massoniana forests shifted from being dominated by Chloroflexi to being dominated by Proteobacteria (Figure 3). According to the oligotrophic‐copiotrophic concept, copiotrophic bacteria typically have high growth rates under nutrient‐rich conditions, while oligotrophic bacteria have lower growth rates but can sustain growth under nutrient‐poor conditions (Liu et al, 2023). Chloroflexi are oligotrophic bacteria that primarily obtain nutrients through photosynthesis.…”

“…The soil samples were subsequently sent to Shanghai Paisino Biotechnology Co., Ltd., to determine the abundance of soil bacteria and fungi via absolute quantitative PCR technology. During the experiment, the primers used for bacteria were 16S_338F (ACTCCTACGGGAGG CAGCA) and 16S_519R (ATTACCGCGGCTGCTGG), while the primers used for fungi were ITS5F (GGAAGTAAAAGTCGTAACAAGG) and ITS1R (GCTGCGTTCTTCATCGATGC) (Liu et al, 2023;Xiao et al, 2018). PCR amplification was performed using the target gene primers with the following reaction mixture: 1 μL of the upstream primer, 1 μL of the downstream primer, 1 μL of template, 25 μL of 2 Â Taq MasterMix, and 22 μL of water.…”

“…These results also indicate that soil fertility has a greater impact on fungi than on bacteria (Figure 9). This may be because soil fungi play a different role in the soil, primarily by decomposing organic matter and converting it into plant-accessible nutrients (Liu et al, 2023). In contrast, soil bacteria are more involved in nutrient transformation and cycling processes.…”

Reciprocal stream–riparian fluxes: effects of distinct exposure patterns on litter decomposition

“…Although litter-associated terrestrial fungi were thought to become inactive upon submersion (Krauss et al 2011), recent reports show that some may be able to maintain growth in submerged conditions (Hayer et al 2022). Their contribution to decomposition under such environments is still unclear (Graça and Ferreira 1995;Nikolcheva et al 2005) but should not be ruled out (Kuehn 2016;Liu et al 2023). As potential antagonistic interspecific interactions occur at a metabolic cost (Hiscox et al 2015), this may explain a higher microbial activity (but similar fungal biomass) found in leaves initially maintained for longer periods in the riparian area.…”