Mining gut microbiome oligopeptides by functional metaproteome display

Abstract

Pathogen infections, autoimmune diseases, and chronic inflammatory disorders are associated with systemic antibody responses from the host immune system. Disease-specific antibodies can be important serum biomarkers, but the identification of antigens associated with specific immune reactions is challenging, in particular if complex communities of microorganisms are involved in the disease progression. Despite promising new diagnostic opportunities, the discovery of these serological markers becomes more difficult with increasing complexity of microbial communities. In the present work, we used a metagenomic M13 phage display approach to select immunogenic oligopeptides from the gut microbiome of transgenic mice suffering from chronic ileitis. We constructed three individual metaproteome phage display libraries with a library size of approximately 107 clones each. Using serum antibodies, we selected and validated three oligopeptides that induced specific antibody responses in the mouse model. This proof-of-concept study provides the first successful application of functional metaproteome display for the study of protein-protein interactions and the discovery of potential disease biomarkers.

Pyruvate dehydrogenase complex—enzyme 2, a new target for Listeria spp. detection identified using combined phage display technologies

“…Another application of phage display is for the display of entire ORFeomes and metagenomes. This technique, which employs a library built with antigen fragments from bacterial genomes, metagenomes, or cDNA, was described to allow the discovery of novel oligopeptide markers using sera or other sources of polyclonal antibodies 40,41,57,58 . Even though this ORFeome application could be used in the present study using polyclonal antibodies against Listeria, it would provide information about immunogenic proteins that are applicable for indirect detection.…”

An efficient ORF selection system for DNA fragment libraries based on split beta-lactamase complementation

“…Such libraries can also be transferred to different surface display systems for identification of immunodominant epitopes using patient sera [ 15 – 18 , 49 ]. Zantow et al, have employed ORF-selected DNA fragment libraries of gut microbiome to study protein-protein interactions and identify novel biomarkers [ 12 ]. This new ORF selection system will also find use in the enrichment of functional clones during construction of large phage-displayed human antibody libraries to improve the efficiency of specific antibody binders as described previously using full-length beta-lactamase [ 27 , 50 , 51 ].…”

“…DNA fragment libraries have been successfully employed for a variety of applications including mining of gut microbiome to study protein-protein interactions and identify novel biomarkers, epitope mapping of monoclonal and polyclonal antibodies, identification of soluble portions of multi-domain proteins, identification of immunodominant epitopes of pathogenic proteins using patient sera, etc. [10][11][12][13][14][15][16][17][18][19]. Such libraries are created by random fragmentation of the DNA encoding the target genome or selected gene sequences, followed by cloning into suitable expression or surface display vectors.…”

Development of Neutralizing and Non-neutralizing Antibodies Targeting Known and Novel Epitopes of TcdB of Clostridioides difficile

“…The pHORF- tcdB -fragment library was generated as described before (Zantow et al, 2016) with minor adjustments. In brief, tcdB was amplified from genomic DNA of Clostridioides difficile strain 630 (kindly provided by Meina Neumann-Schaal, DSMZ) by PCR using Phusion DNA polymerase and the following oligonucleotides as primers: 5′ATGAGTTTAGTTAATAGAAAACAGTTAGAAAAAATGG 3′ (forward),5′CTATTCACTAATCACTAATTGAGCTGTATCAGG 3′ (reverse)…”

“…Determination of transformation rate and packaging of oligopeptide phage library and ORF enrichment was performed as described before (Zantow et al, 2016). Gene coverage and ORF enrichment was analyzed by sequencing of individual E. coli XL1 blue MRF' clones infected with TcdB-gene fragment phage.…”