miR-16-5p Is a Stably-Expressed Housekeeping MicroRNA in Breast Cancer Tissues from Primary Tumors and from Metastatic Sites

Rinnerthaler, Gabriel; Hackl, Hubert; Gampenrieder, Simon Peter; Hamacher, Frank; Hufnagl, Clemens; Hauser‐Kronberger, Cornelia; Zehentmayr, Franz; Fastner, Gerd; Sedlmayer, Felix; Mlineritsch, Brigitte; Greil, Richard

doi:10.3390/ijms17020156

Cited by 73 publications

(46 citation statements)

References 47 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Without a consensus about the ideal reference gene to study miRNA expression in plasma, we opted for miR‐16‐5p because it has been demonstrated to be stably expressed in plasma of several different mouse strains at different ages and disease conditions (Mi et al , ). Moreover, Rinnerthaler et al () have demonstrated that miR‐16‐5p is also stably expressed in breast cancer tissues, both from primary and metastatic sites, indicating that it is a good housekeeping gene for our study, which was further confirmed by qPCR data. qPCR results (Fig.…”

Section: Resultssupporting

confidence: 75%

Downregulation of circulating miR 802‐5p and miR 194‐5p and upregulation of brain MEF2C along breast cancer brain metastasization

et al. 2020

View full text Add to dashboard Cite

Breast cancer brain metastases (BCBMs) have been underinvestigated despite their high incidence and poor outcome. MicroRNAs (miRNAs), and particularly circulating miRNAs, regulate multiple cellular functions, and their deregulation has been reported in different types of cancer and metastasis. However, their signature in plasma along brain metastasis development and their relevant targets remain undetermined. Here, we used a mouse model of BCBM and next‐generation sequencing (NGS) to establish the alterations in circulating miRNAs during brain metastasis formation and development. We further performed bioinformatics analysis to identify their targets with relevance in the metastatic process. We additionally analyzed human resected brain metastasis samples of breast cancer patients for target expression validation. Breast cancer cells were injected in the carotid artery of mice to preferentially induce metastasis in the brain, and samples were collected at different timepoints (5 h, 3, 7, and 10 days) to follow metastasis development in the brain and in peripheral organs. Metastases were detected from 7 days onwards, mainly in the brain. NGS revealed a deregulation of circulating miRNA profile during BCBM progression, rising from 18% at 3 days to 30% at 10 days following malignant cells’ injection. Work was focused on those altered prior to metastasis detection, among which were miR‐802‐5p and miR‐194‐5p, whose downregulation was validated by qPCR. Using targetscan and diana tools, the transcription factor myocyte enhancer factor 2C (MEF2C) was identified as a target for both miRNAs, and its expression was increasingly observed in malignant cells along brain metastasis development. Its upregulation was also observed in peritumoral astrocytes pointing to a role of MEF2C in the crosstalk between tumor cells and astrocytes. MEF2C expression was also observed in human BCBM, validating the observation in mouse. Collectively, downregulation of circulating miR‐802‐5p and miR‐194‐5p appears as a precocious event in BCBM and MEF2C emerges as a new player in brain metastasis development.

show abstract

Section: Resultssupporting

confidence: 75%

Downregulation of circulating miR 802‐5p and miR 194‐5p and upregulation of brain MEF2C along breast cancer brain metastasization

et al. 2020

View full text Add to dashboard Cite

show abstract

“…The qRT-PCR was performed using a Bio-Rad CFX Connect Real-time System (Bio-Rad), with the threshold cycle number determined by Bio-Rad CFX manager software V.3.0. mRNA expression was normalized to HPRT (29) and miRNA expression was normalized to miR-16-5p (30,31). The following primers were used for PCR analysis: miR-196b-5p 5′‑TAGGTAGTTTCCTGTTGTTGGG‑′3 (sense) and 5′‑GCGAGCACAGAATTAATACGAC‑′3 (anti-sense), miR-16-5p 5′-TAGCAGCACGTAAATATTGGCG‑′3 (sense), 5′‑GCGAGCACAGAATTAATACGAC‑′3 (anti-sense), HOXA10 5′‑ AGATATTGTCCTAAGTGTCAAGTCCTGA‑′3 (sense), 5′‑GCCATTTCGAGCAGTGGG‑′3(anti-sense), TFF1 5′‑GGTCCTGGTGTCCATGCTG‑′3 (sense), 5′‑ACAGCAGCCCTTATTTGCAC‑′3(anti-sense).…”

Section: Methodsmentioning

confidence: 99%

Methylation of the HOXA10 Promoter Directs miR-196b-5p–Dependent Cell Proliferation and Invasion of Gastric Cancer Cells

Shao

Chen

Peng

et al. 2018

Molecular Cancer Research

View full text Add to dashboard Cite

The cross-talk between epigenetics and miRNA expression plays an important role in human tumorigenesis. Herein, the regulation and role of miR-196b-5p in gastric cancer was investigated. Quantitative real-time RT-PCR (qPCR) demonstrated that miR-196b-5p is significantly overexpressed in human gastric cancer tissues (P<0.01). In addition, it was determined that HOXA10, a homeobox family member and host gene for miR-196b-5p, is overexpressed and positively correlated with miR-196b-5p expression levels (P<0.001). Quantitative pyrosequencing methylation analysis, demonstrated significantly lower levels of DNA methylation at the HOXA10 promoter in gastric cancer, as compared to non-neoplastic gastric mucosa specimens. 5-Aza-2′-deoxycytidine treatment confirmed that demethylation of HOXA10 promoter induces the expression of HOXA10 and miR-196b-5p in gastric cancer cell model systems. Using the Tff1-KO mouse model of gastric neoplasia, hypo-methylation and overexpression of HOXA10 and miR-196b-5p in gastric tumors was observed, as compared to normal gastric mucosa from Tff1-WT mice. Mechanistically, reconstitution of TFF1 in human gastric cancer cells lead to an increased HOXA10 promoter methylation with reduced expression of HOXA10 and miR-196b-5p. Functionally, miR-196b-5p reconstitution promoted human gastric cancer cell proliferation and invasion in vitro. In summary, the current data demonstrates overexpression of miR-196b-5p in gastric cancer and suggests that TFF1 plays an important role in suppressing the expression of miR-196b-5p by mediating DNA methylation of the HOXA10 promoter. Loss of TFF1 expression may promote proliferation and invasion of gastric cancer cells through induction of promoter hypo-methylation and expression of the HOXA10/miR-196b-5p axis.

show abstract

“…In undifferentiated P19 cells, miR-126 can damage actin fibers and maintain microtubular stability (Rinnerthaler et al 2016), and it can reduce Cdc42 protein level and affect the intracellular localization of Rac1 through the Rho GTPase family, thereby influencing axonal growth . As a microRNA potentially inhibiting the malignant progression of glioma, miR-126 may affect its motility and migration through cytoskeleton-associated proteins.…”

Section: Introductionmentioning

confidence: 99%

miR-126 affects the invasion and migration of glioma cells through GATA4

et al. 2016

Artificial Cells, Nanomedicine, and Biotechnology

View full text Add to dashboard Cite

We aimed to explore the relationship between miR-126 and glioma. miR-126 was highly expressed in low-grade clinical glioma tissue samples but lowly expressed in high-grade ones (P < .01). A human endogenous miR-126 expression vector was constructed. The migration capacity of cells transfected with the vector significantly decreased (P < .05). Up-regulation of miR-126 suppressed GATA4 protein expression. After transfection, they slightly contracted and became ovally or spherically shaped. F-actin significantly reduced, and microfilaments shortened or disappeared. The number of membrane-penetrating cells significantly decreased (P < .01). miR-126 inhibits the migration and invasion of glioma cells, which may be linked to GATA4 as a target gene.

show abstract

miR-16-5p Is a Stably-Expressed Housekeeping MicroRNA in Breast Cancer Tissues from Primary Tumors and from Metastatic Sites

Cited by 73 publications

References 47 publications

Downregulation of circulating miR 802‐5p and miR 194‐5p and upregulation of brain MEF2C along breast cancer brain metastasization

Downregulation of circulating miR 802‐5p and miR 194‐5p and upregulation of brain MEF2C along breast cancer brain metastasization

Methylation of the HOXA10 Promoter Directs miR-196b-5p–Dependent Cell Proliferation and Invasion of Gastric Cancer Cells

miR-126 affects the invasion and migration of glioma cells through GATA4

Contact Info

Product

Resources

About