miR-Q: a novel quantitative RT-PCR approach for the expression profiling of small RNA molecules such as miRNAs in a complex sample

Abstract

Background: MicroRNAs (miRNAs) are small endogenous non-coding interfering RNA molecules regarded as major regulators in eukaryotic gene expression. Different methods are employed for miRNA expression profiling. For a better understanding of their role in essential biological processes, convenient methods for differential miRNA expression analysis are required.

High-performance quantification of mature microRNAs by real-time RT-PCR using deoxyuridine-incorporated oligonucleotides and hemi-nested primers

“…Previously, discrimination of let-7 homologs was achieved with TaqMan real-time RT-PCR assays, whereby after a miRNA-specific RT, a common reverse primer was used for PCR and a miRNA-specific TaqMan probe was required for discrimination (Chen et al 2005). Assays with a similar strategy, but without the use of fluorescent probes, suffered from a significantly poorer discrimination of the let-7 homologs (Raymond et al 2005;Shi and Chiang 2005;Sharbati-Tehrani et al 2008). We hypothesized and showed that the specificity of the assays can be dramatically enhanced by a hemi-nested miRNAspecific reverse PCR primer and do not require the use of a fluorescent probe.…”

“…1). Initially, we noticed that in a number of previous reports (Chen et al 2005;Raymond et al 2005;Shi and Chiang 2005;Duncan et al 2006;Varkonyi-Gasic et al 2007;Sharbati-Tehrani et al 2008;Yang et al 2009), the reverse PCR primers were designed to anneal directly to the sequences in the RT oligonucleotide. To achieve specificity, a unique miRNA-specific fluorescent probe is required to discriminate the targets from the nonspecific amplicons (Chen et al 2005).…”

“…Furthermore, with the escalating identification of hundreds of candidate miRNAs by deep sequencing (Bar et al 2008;Goff et al 2009), the design of the TaqMan probe for each of the novel miRNAs is not only cost prohibitive, but also technically challenging, and it faces practical difficulties (Varkonyi-Gasic et al 2007). Attempts have been made to improve miRNA detection without reliance on fluorescent probes (Raymond et al 2005;Shi and Chiang 2005;Sharbati-Tehrani et al 2008); however, these assays usually involved multiple sample processing steps (Shi and Chiang 2005) and suffered from a limited dynamic range of detection (Raymond et al 2005) and/or poor specificity against homologous miRNAs (Raymond et al 2005;Shi and Chiang 2005;Sharbati-Tehrani et al 2008). It has been noticed that a consensus strategy of these assays and some other TaqMan assays (Varkonyi-Gasic et al 2007;Yang et al 2009) is to use a universal or common reverse PCR primer and/or a fluorescent probe for amplification and detection of multiple miRNAs.…”

Oncogenic MicroRNA-155 Down-regulates Tumor Suppressor CDC73 and Promotes Oral Squamous Cell Carcinoma Cell Proliferation

“…miR-Q RT-PCR-The miR-155 expression analysis was carried out by miR-Q, a method developed by Sharbati-Tehrani et al (25) for the expression analysis of miRNA by RT-PCR. The expression of miR-155 in OSCC samples was compared with normal tissues using the 2 Ϫ⌬⌬CT method and 5 S rRNA as a normalizing control (26).…”

Transcriptional Regulation of the Protocadherin β Cluster during Her-2 Protein-induced Mammary Tumorigenesis Results from Altered N-Glycan Branching

“…Real Time PCR Detection of miR-21-Mature miR-21 was detected using the miR-Q method as described previously (30,31). In brief, 500 ng of total RNA was used for reverse transcription of mature miR-21 using TaqMan reverse transcription reagents (Applied Biosystems) with a specific reverse primer (RT6-miR-21, tgtcaggcaaccgtattcaccgtgagtggttcaaca).…”