miR128-1 inhibits the growth of glioblastoma multiforme and glioma stem-like cells via targeting BMI1 and E2F3

Shan, Zhengnan; Tian, Rui; Zhang, Min; Gui, Zhaohua; Wu, Jing; Min, Di; Zhou, Xin‐Fu; He, Jie

doi:10.18632/oncotarget.12385

Cited by 59 publications

(49 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…RT-PCR was performed on a 7500 real-time-PCR System (Applied Biosystems, Carlsbad, CA, USA) using Taqman probes for miR-29a (Applied Biosystems, 4427975) and primers for Bmi1. The sequence of the primers: Primer sets (5'-3') were as follows: Bmi1: CACCAGAGAGATGGACTGACAA and AGGAAACTGTGGATGAGGAGAC [21]. The 2 -ΔΔCt method was used to calculate expression levels.…”

Section: Quantitative Real-time Pcr (Qrt-pcr)mentioning

confidence: 99%

MicroRNA-29a Inhibits Growth, Migration and Invasion of Melanoma A375 Cells in Vitro by Directly Targeting BMI1

Xiong

Liu

Qiu

et al. 2018

Cell Physiol Biochem

View full text Add to dashboard Cite

Background/Aims: Melanoma is one of the most aggressive malignant tumors, with increasing incidence, poor prognosis, and lack of any effective targeted therapies. Abnormal expression of miR-29a has been found in several types of cancers, including melanoma. In this study, experiments were performed to investigate the role of miR-29a in melanoma, and the molecular mechanism by which miR-29a represses melanoma. Methods: miR-29 and Bmi1 expression was examined by quantitative real-time polymerase chain reaction (qRT-PCR). The cell viability, apoptosis, migration and invasion were respectively determined by Cell Counting Kit-8 assay, Propidium iodide (PI) fluorescein isothiocynate (FITC)-Annexin V staining assay, wound healing assay and transwell assay. Luciferase reporter assay was performed to determine a target gene of miR-29a. Western blot was used to analyze protein expression of apoptosis-related proteins, Bmi1, Wnt/β-catenin and Nuclear factor-κB (NF-κB) pathway target genes. Results: miR-29a was down-regulated in all tested melanoma cell lines. Up-regulation of miR-29a effectively inhibited cell viability, migration, and invasion, but promoted apoptosis in A375 cells. Bmi1 was a direct target gene of miR-29a. Transfection with miR-29a mimic decreased cell migration and invasion and Bmi1 expression in Malme-3M cells, SK-MEL-2, SK-MEL-5, and M14 cell lines. Moreover, miR-29a might suppress growth, migration and invasion of A375 cells by negatively regulating Bmi1. In addition, our results demonstrated that transfection with miR-29a mimic effectively blocked Wnt/β-catenin and NF-κB pathways via down-regulating Bmi1. Conclusion: miR-29a could be functioned as a potential tumor suppressor through direct regulation of Bmi1 in melanoma cells.

show abstract

Section: Quantitative Real-time Pcr (Qrt-pcr)mentioning

confidence: 99%

MicroRNA-29a Inhibits Growth, Migration and Invasion of Melanoma A375 Cells in Vitro by Directly Targeting BMI1

Xiong

Liu

Qiu

et al. 2018

Cell Physiol Biochem

View full text Add to dashboard Cite

show abstract

“…miR‐128 was reported as oncogene or tumour suppressor in various cancers. For example, miR‐128 was reported to be downregulated in cancer tissues and represses growth and metastasis of bladder cancer, lung cancer, and glioblastoma multiforme . However, different studies of the miR‐128 in carcinoma reported discordant conclusions.…”

Section: Discussionmentioning

confidence: 99%

NAIF1 suppresses osteosarcoma progression and is regulated by miR‐128

Kong

Zhang

2018

Cell Biochemistry & Function

View full text Add to dashboard Cite

Nuclear apoptosis‐inducing factor 1 (NAIF1) acts as an oncogene and involves in tumorigenesis in several cancers. However, the expression and mechanism of NAIF1 in osteosarcoma remains unclear. In this study, we demonstrated the downregulation of NAIF1 expression in both osteosarcoma tissues and cell lines. We next explored the potential role of NAIF1 in osteosarcoma cell proliferation and migration. The result showed that overexpression of NAIF1 evidently suppressed the cell proliferation and invasion of osteosarcoma. Furthermore, we investigated the potential mechanisms accounting for dysregulation of NAIF1 in osteosarcoma. The bioinformatic prediction and luciferase reporter assay revealed that miR‐128 is a direct upstream regulator of NAIF1 and regulates NAIF1 expression by binding the 3′‐UTR of NAIF1. Consistent with previous study, we found that miR‐128 was upregulated in both osteosarcoma tissues and cell lines. Moreover, miR‐128 expression levels were inversely correlated with that of NAIF1 in osteosarcoma tissues. Finally, functional assay showed that miR‐128 significantly suppressed osteosarcoma progression partially mediated by inhibiting NAIF1 expression. These data indicate that the miR‐128 and its target gene NAIF1 played important roles by regulating OS cell proliferation and migration phenotype. Significance of the study Osteosarcoma (OS) is the most common malignant bone tumour and the second leading cause of cancer‐related death affecting children and adolescents. Nuclear apoptosis‐inducing factor 1 (NAIF1) plays an inhibitory role in the initial steps of different carcinomas. However, the expression and mechanism of NAIF1 in osteosarcoma remains unclear. The data of this study indicated that the miR‐128 and its target gene NAIF1 played important roles by regulating OS cell proliferation and migration phenotype. It was demonstrated that NAIF1 would demonstrate important regulative effects and may be a promising therapeutic target of OS.

show abstract

“…miR-128-1 is supposed to act as a tumor suppressor inhibiting tumor cell proliferation, invasion and self-renewal by direct targeting of bMI1 and E2F3 in glioblastomas (67). Furthermore, it has been associated with inhibition of the mTOR signaling pathway in glioblastomas.…”

Section: Discussionmentioning

confidence: 99%

Hypoxia- and acidosis-driven aberrations of secreted microRNAs in endometrial cancer in vitro

et al. 2017

View full text Add to dashboard Cite

Abstract. Due to their post-transcriptional regulatory impact on gene expression, microRNAs (miRNA, miRs) influence decisively cellular processes of differentiation, proliferation and apoptosis. In oncogenic pathways various miRNAs exert either oncogenic or tumor suppressor activities in a stage-specific manner. Dysregulation of miRNA expression pattern has been associated with several human cancers including endometrial cancer (EC). In the present study, expression profile alterations of EC associated secreted miRNAs were determined under the microenvironmental stress situations hypoxia and acidosis occurring in tumor progression and metastasis. The potential influence of hypoxia and acidosis vs. control conditions on the expression levels of 24 EC-relevant miRNA types was quantitatively accessed via real-time PCR in three established EC in vitro models. Expression data were analyzed statistically. In vitro application of hypoxia resulted in downregulation of miR-15a, miR-20a, miR-20b and miR-128-1 in Ishikawa cells (type I EC) and upregulation of miR-21 in EFE-184 cells (type I EC). Acidosis triggered upregulation of tumor promoting miR125b in AN3-CA cell (type II EC), whereas in Ishikawa cells (type I EC) miRNAs with tumor suppressive function were found altered in divergent directions, both up-(let-7a) and down-(miR-22) regulated. Our current findings emphasize the functional importance of secreted miRNAs in the immediate response of EC cells to exogenic stress situations such as the typical tumor epiphenomena hypoxia and acidosis. Focusing on the specific potential of secreted, thus circulating miRNA molecules, alterations in expression levels not only influence intracellular gene expression and signaling cascades, but also transfer the induction of (tumor)biological cellular changes to adjacent cells.

show abstract

miR128-1 inhibits the growth of glioblastoma multiforme and glioma stem-like cells via targeting BMI1 and E2F3

Cited by 59 publications

References 35 publications

MicroRNA-29a Inhibits Growth, Migration and Invasion of Melanoma A375 Cells in Vitro by Directly Targeting BMI1

MicroRNA-29a Inhibits Growth, Migration and Invasion of Melanoma A375 Cells in Vitro by Directly Targeting BMI1

NAIF1 suppresses osteosarcoma progression and is regulated by miR‐128

Hypoxia- and acidosis-driven aberrations of secreted microRNAs in endometrial cancer in vitro

Contact Info

Product

Resources

About