2012
DOI: 10.1007/s00405-012-2066-8
|View full text |Cite
|
Sign up to set email alerts
|

Mitochondrial ribosome and Ménière’s disease: a pilot study

Abstract: Ménière's disease patients experience vestibular disability. When most of medical treatments fail, a chemical labyrinthectomy using aminoglycosides is indicated. However, this process frequently causes hearing damage. Aminoglycosides, interacting with mitochondrial rRNAs, alter mitochondrial protein synthesis and the oxidative phosphorylation system, which provide most of the energy in sensory hair cells. For this reason, we hypothesized that genetic variation in mitochondrial rRNA genes and in two nuclear gen… Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
2
1
1
1

Citation Types

0
8
0

Year Published

2013
2013
2024
2024

Publication Types

Select...
6

Relationship

2
4

Authors

Journals

citations
Cited by 9 publications
(8 citation statements)
references
References 22 publications
0
8
0
Order By: Relevance
“…The fact that aminoglycosides also cause a decrease in eukaryotic translational fidelity permitted to initiate efforts to developed them as drugs to treat nonsense mutation related genetic disorders such as cystic fibrosis and Duchenne muscular dystrophy (Rich et al, 1990; Kellermayer, 2006; Hermann, 2007; Kondo et al, 2007; Zingman et al, 2007; Bidou et al, 2012; Kandasamy et al, 2012). A chemical labyrinthectomy using intratympanic injection of aminoglycosides is used when most treatments of Ménière's disease fail (Huon et al, 2012; Pacheu-Grau et al, 2012). Aminoglycoside-based drugs are also inhibitors of reproduction of the HIV virus, a property that could result in their utilization in the treatment of AIDS patients (Houghton et al, 2010).…”
Section: Aminoglycosides and Resistancementioning
confidence: 99%
“…The fact that aminoglycosides also cause a decrease in eukaryotic translational fidelity permitted to initiate efforts to developed them as drugs to treat nonsense mutation related genetic disorders such as cystic fibrosis and Duchenne muscular dystrophy (Rich et al, 1990; Kellermayer, 2006; Hermann, 2007; Kondo et al, 2007; Zingman et al, 2007; Bidou et al, 2012; Kandasamy et al, 2012). A chemical labyrinthectomy using intratympanic injection of aminoglycosides is used when most treatments of Ménière's disease fail (Huon et al, 2012; Pacheu-Grau et al, 2012). Aminoglycoside-based drugs are also inhibitors of reproduction of the HIV virus, a property that could result in their utilization in the treatment of AIDS patients (Houghton et al, 2010).…”
Section: Aminoglycosides and Resistancementioning
confidence: 99%
“…Ten became deaf and eleven retained their hearing ability. However, they did not have the mt-rRNA pathogenic mutation and we did not discover amino acid substitutions that could explain the phenotype (Pacheu-Grau et al, 2012 ).…”
Section: Resultsmentioning
confidence: 95%
“…To locate mutations, the human rCRS (GenBank NC_012920) was used. The sequencing of Cercopithecidae MRPS12 was also performed as already explained (Pacheu-Grau et al, 2012 ), but using specific primers for these species Fw: CACTAAGATCTGTTCTCTGCC and Rv: ACTCCACAAGGGTTCACATC. To locate mutations, the Macaca mulatta MRPS12 cDNA (Ensembl Transcript Id: ENSMMUT00000038520) was used.…”
Section: Methodsmentioning
confidence: 99%
“…The presence of the m.3472T>C mutation in Spaniard controls and patients suffering from optic neuropathy was performed by PCR‐RFLP or qRT‐PCR, respectively. This qRT‐PCR was performed with TaqMan reagents including two primers around the m.3472T>C position and two probes: a fluorophore VIC‐labelled probe specific for one allele and other fluorophore FAM‐labelled probe specific for the other allele . The mtDNA levels were determined according protocols previously published …”
Section: Methodsmentioning
confidence: 99%
“…This qRT-PCR was performed with TaqMan reagents including two primers around the m.3472T>C position and two probes: a fluorophore VIC-labelled probe specific for one allele and other fluorophore FAM-labelled probe specific for the other allele. 6 The mtDNA levels were determined according protocols previously published. 5 Construction and maintenance of transmitochondrial cell lines.…”
Section: Molecular Genetic Analysismentioning
confidence: 99%