Mitochondrial shuttling of CAP1 promotes actin- and cofilin-dependent apoptosis

Wang, Changhui; Zhou, Guowei; Vedantam, Srilakshmi; Li, Peng; Field, Jeffrey

doi:10.1242/jcs.023911

Cited by 84 publications

(71 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Increased apoptosis was more prominent in failing hearts and in hearts, which had already developed DCM. Whereas a link between CAP and apoptosis has been established for CAP1 and yeast CAP, such a connection has not been investigated for CAP2 and it is unclear at present what the underlying mechanism might be [15,30]. One possibility is that genes in the surroundings of the Cap2 locus are affected in their activity by the genetic manipulation.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Ablation of cyclase-associated protein 2 (CAP2) leads to cardiomyopathy

Peche

Holak

Burgute

et al. 2012

Cell. Mol. Life Sci.

View full text Add to dashboard Cite

Cyclase-associated proteins are highly conserved proteins that have a role in the regulation of actin dynamics. Higher eukaryotes have two isoforms, CAP1 and CAP2. To study the in vivo function of CAP2, we generated mice in which the CAP2 gene was inactivated by a gene-trap approach. Mutant mice showed a decrease in body weight and had a decreased survival rate. Further, they developed a severe cardiac defect marked by dilated cardiomyopathy (DCM) associated with drastic reduction in basal heart rate and prolongations in atrial and ventricular conduction times. Moreover, CAP2-deficient myofibrils exhibited reduced cooperativity of calciumregulated force development. At the microscopic level, we observed disarrayed sarcomeres with development of fibrosis. We analyzed CAP2's role in actin assembly and found that it sequesters G-actin and efficiently fragments filaments. This activity resides completely in its WASP homology domain. Thus CAP2 is an essential component of the myocardial sarcomere and is essential for physiological functioning of the cardiac system, and a deficiency leads to DCM and various cardiac defects.

show abstract

Section: Discussionmentioning

confidence: 99%

“…CAP in lower eukaryotes as well as mouse CAP1 are involved in cell polarity, motility, and receptor-mediated endocytosis [12][13][14]. Additionally, mammalian CAP1 was shown to be a proapoptotic protein [15].…”

Section: Introductionmentioning

confidence: 99%

Ablation of cyclase-associated protein 2 (CAP2) leads to cardiomyopathy

Peche

Holak

Burgute

et al. 2012

Cell. Mol. Life Sci.

View full text Add to dashboard Cite

show abstract

“…Expression Plasmids, shRNA Constructs, and Generation of CAP1 Re-expression Cells-The mouse CAP1 GFP fusion protein and deletion mutants have been described previously (30). To generate constructs expressing GST-cofilin (wild type and S3D), wild type (WT) human cofilin and the S3D mutant were subcloned into the BamHI and NotI sites of the pGEX4T-2 vector.…”

Section: Methodsmentioning

confidence: 99%

“…To express His 6 -tagged mouse CAP1 in mammalian cells, mouse Cap1 was cloned into the BamHI and NotI sites of the pcDNA4 vector using a forward primer GGATCCATTATGGCTGACATG and a reverse primer GCGGCCGCTTATCCAGCAATT. shRNA constructs targeting human CAP1 on a pRNA-U6.1/ Neo vector and establishment of CAP1 KD HeLa stable cells have been described previously (30). The target sequences for two shRNA constructs are 5Ј-AGATGTGGATAAGAA-GCAT-3Ј (S2, nucleotides 519 -537) and 5Ј-CACGACATTG-CAAATCAAG-3Ј (S3, nucleotides 1074 -1092).…”

Section: Methodsmentioning

confidence: 99%

Mammalian Adenylyl Cyclase-associated Protein 1 (CAP1) Regulates Cofilin Function, the Actin Cytoskeleton, and Cell Adhesion

Zhang

Ghai

Wu³

et al. 2013

Journal of Biological Chemistry

Self Cite

100

View full text Add to dashboard Cite

Background: Mammalian CAP1 functions in actin dynamics, with elusive mechanisms. Results: Knockdown of CAP1 in HeLa cells leads to alterations in the actin cytoskeleton, cofilin, and FAK phosphorylation and increased cell adhesion and motility. Conclusion: Mammalian CAP1 regulates actin cytoskeleton, cofilin, and FAK phosphorylation as well as cell adhesion. Significance: This work presents a novel function for CAP1 in cell adhesion and insights into the CAP1/cofilin interactions.

show abstract

“…Our finding that alterations in [pH] cyt also trigger alterations in actin, ADF, and CAP localization is unique and places these in a unique, biologically relevant scenario involving PCD in pollen. It is of interest that overexpression of wild-type CAP1 in several animal cells stimulated cofilin/ADF-induced apoptosis (Wang et al, 2008). Although it is relatively well established that actin can act as both a sensor and a mediator of cell death, translating stress signals into alterations in actin polymerization status (Franklin-Tong and Gourlay, 2008;Desouza et al, 2012), relatively few studies have examined this in plant cells with respect to a mechanistic understanding.…”

Section: Identification Of Targets For Ph Alterationsmentioning

confidence: 99%

Self-Incompatibility-Induced Programmed Cell Death in Field Poppy Pollen Involves Dramatic Acidification of the Incompatible Pollen Tube Cytosol

et al. 2015

View full text Add to dashboard Cite

Self-incompatibility (SI) is an important genetically controlled mechanism to prevent inbreeding in higher plants. SI involves highly specific interactions during pollination, resulting in the rejection of incompatible (self) pollen. Programmed cell death (PCD) is an important mechanism for destroying cells in a precisely regulated manner. SI in field poppy (Papaver rhoeas) triggers PCD in incompatible pollen. During SI-induced PCD, we previously observed a major acidification of the pollen cytosol. Here, we present measurements of temporal alterations in cytosolic pH ([pH] cyt ); they were surprisingly rapid, reaching pH 6.4 within 10 min of SI induction and stabilizing by 60 min at pH 5.5. By manipulating the [pH] cyt of the pollen tubes in vivo, we show that [pH] cyt acidification is an integral and essential event for SI-induced PCD. Here, we provide evidence showing the physiological relevance of the cytosolic acidification and identify key targets of this major physiological alteration. A small drop in [pH] cyt inhibits the activity of a soluble inorganic pyrophosphatase required for pollen tube growth. We also show that [pH] cyt acidification is necessary and sufficient for triggering several key hallmark features of the SI PCD signaling pathway, notably activation of a DEVDase/caspase-3-like activity and formation of SI-induced punctate actin foci. Importantly, the actin binding proteins Cyclase-Associated Protein and ActinDepolymerizing Factor are identified as key downstream targets. Thus, we have shown the biological relevance of an extreme but physiologically relevant alteration in [pH] cyt and its effect on several components in the context of SI-induced events and PCD.

show abstract

Mitochondrial shuttling of CAP1 promotes actin- and cofilin-dependent apoptosis

Abstract: Mitochondria play a central role in programmed cell death through both apoptotic and necrotic signals (Gross et al

Cited by 84 publications

References 42 publications

Ablation of cyclase-associated protein 2 (CAP2) leads to cardiomyopathy

Ablation of cyclase-associated protein 2 (CAP2) leads to cardiomyopathy

Mammalian Adenylyl Cyclase-associated Protein 1 (CAP1) Regulates Cofilin Function, the Actin Cytoskeleton, and Cell Adhesion

Self-Incompatibility-Induced Programmed Cell Death in Field Poppy Pollen Involves Dramatic Acidification of the Incompatible Pollen Tube Cytosol

Contact Info

Product

Resources

About