Mmip1: a novel leucine zipper protein that reverses the suppressive effects of Mad family members on c-myc

Abstract

C-myc, a member of the basic helix ± loop ± helix ± leucine zipper (bHLH-ZIP) protein family activates target genes in heterodimeric association with another bHLH-ZIP protein, Max. Max readily homodimerizes, competes with C-myc-Max heterodimers, and represses transcription. Four additional bHLH-ZIP proteins, Mad1, Mxi1, Mad3 and Mad4, heterodimerize with Max and also repress transcription of c-myc-responsive genes. We employed a yeast two-hybid approach to identify proteins which interact with Mxi. We identi®ed a novel ZIP-containing protein, Mmip1 (Mad memberinteracting protein 1) that strongly dimerizes with all four Mad members, but not with c-myc, Max, or with unrelated HLH proteins. The Mmip1-Mxi association is mediated by the ZIP domain of each polypeptide and is as strong or stronger than the associations between cmyc and Max or Max and Mxi1. In vitro, Mmip1 can inhibit DNA binding by Max-Mad heterodimers and, in vivo, can reverse the suppressive e ects of Mad proteins on c-myc functions. Mmip1 is found in a variety of cells types, is induced by serum stimulation, and can be coimmunoprecipitated from ®broblasts in association with Mxi1. By interfering with the dimerization between Max and Mad family member proteins, Mmip1 can indirectly up-regulate the transcriptional activity of c-myc and suppress the antiproliferative actions of Mad proteins.

The Mad1 transcription factor is a novel target of activin and TGF-β action in keratinocytes: possible role of Mad1 in wound repair and psoriasis

“…Mad1 function has recently been shown to be antagonized by the leucine zipper protein Mmip-1 (Gupta et al, 1998) and by the unrelated RING ®nger-containing protein Mmip-2 (Yin et al, 1999). Mmip-1 mRNA was expressed at moderate levels in normal and wounded skin, but its expression was not regulated by injury (Figure 7).…”

“…A mouse mmip1 cDNA probe was obtained using 5'-d(TGAATCTTCCTGGAGAGG)-3' as a 5'-primer and 5'-d(TCGATGGCTGACTTGATC)-3' as a 3'-primer. The ampli®ed fragment corresponds to nucleotides 308 ± 555 of the published cDNA sequence (Gupta et al, 1998;accession number: Y15128). A mouse c-myc cDNA probe was obtained using 5'-d(GTGCTCCAGCCCCAGGTCCT)-3' as a 5'-primer and 5'-d(GTTTATGCACCAGAGTTTCG)-3' as a 3'-primer.…”

The Cohesin SMC3 Is a Target the for β-Catenin/TCF4 Transactivation Pathway

“…SMC3 and SMC1 also are components of the mammalian recombinase (denoted RC-1), a multimeric complex that is involved in chromosomal recombination and single strand DNA repair (49). Earlier, a truncated form of SMC3 has been found to modulate c-MYC-dependent transcription by complexing and sequestering members of the MAX/MAD c-MYC interacting proteins (50). Most of the recognized functions of SMC3 require the presence of this protein in the nucleus either for directing chromosomal segregation or to repair DNA.…”

New Myc-interacting proteins: a second Myc network emerges

“…Max also heterodimerizes with the b/HLH/Z protein Rox/Mnt, which is also implicated in binding to Myc/Max and Mad/ Max DNA binding sites, dierentiation, and transcriptional repression via an mSin3-dependent mechanism Meroni et al, 1997). Max switches from Myc to Mad and probably Mnt during dierentiation (Ayer and Eisenman, 1993;Cultraro et al, 1997;Hurlin et al, 1997;Larsson et al, 1997;Meroni et al, 1997), although Max may not be an obligate partner in all Mad complexes during dierentiation (Gupta et al, 1998;Ryan and Birnie, 1997a). Recent investigations of Max are considered further by Luscher and Larsson in this issue.…”