Modos e tempo de evolução em linhagens do vírus da raiva (RABV) mantidos por reservatórios aéreos e terrestres com base em genomas completos

Oliveira, Rafael de Novaes; Brandão, Paulo Eduardo

doi:10.11606/t.10.2014.tde-15012015-083626

Cited by 2 publications

(5 citation statements)

References 47 publications

(160 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The double-stranded genome-length cDNA (genomic reverse transcription) was synthesized using the antisense primer "Final" (Campos et al, 2011) targeting the 3'UTR 21 first nucleotides of trailer region of the antigenomic RNA (nucleotides 11904-11924 Rabies virus M13215.1 GenBank accession number) and RevertAid Premium Reverse Transcriptase (Fermentas ) (Oliveira, 2014).…”

Section: Full-genome Rt-pcrmentioning

confidence: 99%

See 1 more Smart Citation

Rabies virus diversification in aerial and terrestrial mammals

Oliveira¹,

Freire

Iamarino

et al. 2020

Genet. Mol. Biol.

View full text Add to dashboard Cite

Rabies is a fatal zoonotic infection of the central nervous system of mammals and has been known to humans for millennia. The etiological agent, is a neurotropic RNA virus in the order Mononegavirales, family Rhabdoviridae, genus Lyssavirus. There are currently accepted to be two cycles for rabies transmission: the urban cycle and the sylvatic cycle. The fact that both cycles originated from a common RABV or lyssavirus ancestor and the adaptive divergence that occurred since then as this ancestor virus adapted to a wide range of fitness landscapes represented by reservoir species in the orders Carnivora and Chiroptera led to the emergence of the diverse RABV lineages currently found in the sylvatic and urban cycles. Here we study full genome phylogenies and the time to the most recent common ancestor (TMRCA) of the RABVs in the sylvatic and urban cycles. Results show that there were differences between the nucleotide substitution rates per site per year for the same RABV genes maintained independently in the urban and sylvatic cycles. The results identify the most suitable gene for phylogenetic analysis, heterotachy among RABV genes and the TMRCA for the two cycles.

show abstract

Section: Full-genome Rt-pcrmentioning

confidence: 99%

“…Genomic RABV amplicons (circa 12 kb) were obtained by PCR using a pair of primers targeting the leader and trailer regions of the RABV genome (Campos et al, 2011), 1 mL of genomic cDNA and GoTaqÔ Long PCR Master Mix 2X (Promega) according to the manufacturer's instructions (Oliveira 2014).…”

Section: Full-genome Rt-pcrmentioning

confidence: 99%

Rabies virus diversification in aerial and terrestrial mammals

Oliveira¹,

Freire

Iamarino

et al. 2020

Genet. Mol. Biol.

View full text Add to dashboard Cite

show abstract

“…Phylogenetic tree inferred by maximum‐likelihood analysis of genomic sequences. The clusters are colour‐coded according to the classification proposed by Bourhy et al, , Kuzmin et al, and Oliveira, . AP: Antrozous pallidus ; CJ‐CE: Callithrix jacchus Ceará; CJ‐PE: Callithrix jacchus Pernambuco; DR: Desmodus rotundus ; EFE1 and EF‐E2: Eptesicus fuscus , with predominantly Eastern and Central distribution; EF‐W1 and EF‐W2: Eptesicus fuscus , with predominantly Western distribution; EP2‐BR: Eptesicus 2 Brazil; LB: Lasiurus borealis ; LC: Lasiurus cinereus ; LI: Lasiurus intermedius; LN: Lasionycteris noctivagans ; LS: Lasiurus seminolus ; LX: Lasiurus xanthinus ; MexSK‐1: Mexican skunk, variant 1; My: Myotis yumanensis ; MY‐BR: Myotis Brazil, Eptesicus 1 Brazil; MYsp: Myotis spp.…”

Section: Resultsmentioning

confidence: 99%

“…Using the same dataset as in the present study and the concatenated G and L genes, Oliveira () inferred the time to the most recent common ancestor (TMRCA) of bat‐related and dog‐related RABVs by the Bayesian method and inferred the origin of the first C. jacchus ‐specific RABV lineage to around 1,360 AD. The same study suggested that this C. jacchus lineage divided into the CJ‐CE and CJ‐PE lineages in approximately 1,500 AD, suggesting that this lineage diversified and spread in the north‐east of Brazil at least 500 years ago.…”

Section: Discussionmentioning

confidence: 99%

“…Genomic RABV amplicons (~12 kb) were obtained by PCR using a pair of primers targeting the leader and trailer regions of the RABV genome— Início (5′ ACGCTTAACAACAARATCARAG 3′) and Final (5′ ACGCTTAACAAATAAACAACA 3′) (Campos et al, ), 1 µl of genomic cDNA and GoTaq Long PCR Master Mix 2X (Promega, Madison, WI) according to the manufacturer’s instructions (Oliveira, ).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Non‐human primates as a reservoir for rabies virus in Brazil

Kotait

Oliveira²,

Carrieri

et al. 2018

Zoonoses and Public Health

Self Cite

View full text Add to dashboard Cite

Rabies virus (RABV) does not persist in the environment as it is a very fragile agent. The primary hosts are mammalian species in the orders Carnivora and Chiroptera. Since the late 1980s, RABV has been isolated from non‐human primates, Callithrix jacchus (the white‐tufted marmoset), in four coastal states (Rio Grande do Norte, Ceará, Piauí and Pernambuco) in north‐eastern Brazil, where this species is indigenous. The original habitat of C. jacchus consisted of two Brazilian biomes, the Atlantic Forest and the Caatinga. However, these marmosets have since adapted to other ecosystems as a result of human activities. Between 1988 and 1989, RABV isolates were obtained from white‐tufted marmosets in the state of Rio Grande do Norte, but antigenic and genetic identification studies were not conducted at that time. In the following years, three additional states reported cases (Ceará, Piauí and Pernambuco). In two of these states (Ceará and Piauí), human cases of rabies transmitted by marmosets were reported. According to Brazilian Health Ministry data, at least 19 human cases in which this species was the source of infection were registered in between 1990 and 2016. Recent findings in laboratory tests of 12 rabid samples from humans and marmosets and the regional transmission among these animals for over 20 years, together with the gradual increase in the affected geographic area, support the concept of the emergence of a new RABV reservoir. Regional tourism, the wild animal trade and the cultural practice of maintaining these animals as pets, particularly in coastal regions, appear to be major risk factors for the increase in human cases. Additional epidemiological and ecological studies are required to better understand local disease dynamics and to identify ideal opportunities for prevention and control of this fatal infection.

show abstract

Modos e tempo de evolução em linhagens do vírus da raiva (RABV) mantidos por reservatórios aéreos e terrestres com base em genomas completos

Cited by 2 publications

References 47 publications

Rabies virus diversification in aerial and terrestrial mammals

Rabies virus diversification in aerial and terrestrial mammals

Non‐human primates as a reservoir for rabies virus in Brazil

Contact Info

Product

Resources

About