Modulation of aquaporin 2 expression in the kidney of young goats by changes in nitrogen intake

Elfers, Kristin; Breves, Gerhard; Muscher-Banse, Alexandra S.

doi:10.1007/s00360-014-0849-5

Cited by 14 publications

(9 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Primers and probes (5' → 3') References GAPDH Sense: CAAGGTCATCCATGACCACTTT Wilkens et al (31) Antisense: CGGAAGGGCCATCCACA FAM-CTGTCCACGCCATCACTGCCACCC-TMR CaR Forward: ATCGGGTCCTCCTCGTGTTT Elfers et al (18) Reverse: GGACTTGAAGGCGAAGAAGAA FAM-TGTCATCTGTGCCATTTGGCTCAACAC-TMR PMCA Sense: GGTATTGCTGGAACTGATGTAGCTAA Wilkens et al (32) Reverse: CGTCCCCACATAACTGCTTT FAM-CAATGCTTGTAAAATTGTCATCCGTGAGA-BBQ TRPV6 Forward: TGATGGGAGACACTCACTGG Wilkens et al (31) Reverse: GCAGCTTCTTCTCCAGCATC FAM-TGGCTACAACCTGCGCCCT-BBQ GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CaR, Ca-sensing receptor; TRPV6, transient receptor potential vanilloid channel type 6. Bio-Rad).…”

Section: Genesmentioning

confidence: 99%

Modulation of intestinal calcium and phosphate transport in young goats fed a nitrogen- and/or calcium-reduced diet

Elfers¹,

Wilkens²,

Breves³

et al. 2015

Br J Nutr

Self Cite

View full text Add to dashboard Cite

Feeding ruminants a reduced N diet is a common approach to reduce N output based on rumino-hepatic circulation. However, a reduction in N intake caused massive changes in Ca and inorganic phosphate (P i ) homoeostasis in goats. Although a single dietary Ca reduction stimulated intestinal Ca absorption in a calcitriol-dependent manner, a concomitant reduction of Ca and N supply led to a decrease in calcitriol, and therefore a modulation of intestinal Ca and P i absorption. The aim of this study was to examine the potential effects of dietary N or Ca reduction separately on intestinal Ca and P i transport in young goats. Animals were allocated to a control, N-reduced, Ca-reduced or combined N-and Ca-reduced diet for about 6 − 8 weeks, whereby N content was reduced by 25 % compared with recommendations. In Ussing chamber experiments, intestinal Ca flux rates significantly decreased in goats fed a reduced N diet, whereas P i flux rates were unaffected. In contrast, a dietary Ca reduction stimulated Ca flux rates and decreased P i flux rates. The combined dietary N and Ca reduction withdrew the stimulating effect of dietary Ca reduction on Ca flux rates. The expression of Ca-transporting proteins decreased with a reduced N diet too, whereas P i -transporting proteins were unaffected. In conclusion, a dietary N reduction decreased intestinal Ca transport by diminishing Ca-transporting proteins, which became clear during simultaneous N and Ca reduction. Therefore, N supply in young ruminant nutrition is of special concern for intestinal Ca transport.Key words: Flux rates of calcium and phosphate: Goats: Na + -dependent P i transporter IIb: Transient receptor potential vanilloid channel type 6: Ussing chambersFeeding ruminants a N-reduced diet is preferable for economic and environmental reasons. Dietary crude protein (CP) concentrations of 11 − 12 % were recommended to meet the requirements of growing goats (1) . A reduced dietary N supply was associated with a significant reduction in urinary N excretion (2) due to increased expression of renal urea transporters, and thus greater renal urea re-absorption (3) in goats. In addition, the urea transporting capacity of the ruminal epithelium was increased due to dietary N reduction (4) . By possessing such efficient recycling mechanisms, ruminants such as goats are able to maintain rumen microbes' N supply, and therefore a sufficient synthesis of microbial protein as the most important source for host protein, provided that energy supply to the rumen flora is also adequate for microbial protein synthesis.As monogastric species do not have the similar potential to utilise N efficiently, a low-protein diet changes metabolic pathways seriously. A reduction of dietary protein leads to changes in Ca and inorganic phosphate (P i ) homoeostasis in monogastric animals and humans, including decrease in intestinal Ca absorption, reduced urinary Ca excretion and diminished plasma calcitriol and insulin-like growth factor 1 (IGF1) concentrations (5)(6)(7)(8) .Despite the N-rec...

show abstract

Section: Genesmentioning

confidence: 99%

Modulation of intestinal calcium and phosphate transport in young goats fed a nitrogen- and/or calcium-reduced diet

Elfers¹,

Wilkens²,

Breves³

et al. 2015

Br J Nutr

Self Cite

View full text Add to dashboard Cite

show abstract

“…The reabsorbed urea could be returned to the forestomach system by blood to serve as a source of N for protein synthesis (Starke et al, 2012). Renal absorption of urea is important for water absorption and urine concentration (Elfers et al, 2014) and might therefore be causal for the decreased urine osmolarity in the goats fed an N diet too. In addition to increased expression levels of the UT due to N-reduced feed, young goats showed greater levels of renal aquaporin 1 and 2 expression and increased plasma concentrations of vasopressin (Elfers et al, 2014).…”

Section: Discussionmentioning

confidence: 99%

“…Renal absorption of urea is important for water absorption and urine concentration (Elfers et al, 2014) and might therefore be causal for the decreased urine osmolarity in the goats fed an N diet too. In addition to increased expression levels of the UT due to N-reduced feed, young goats showed greater levels of renal aquaporin 1 and 2 expression and increased plasma concentrations of vasopressin (Elfers et al, 2014). Increased water absorption in the kidneys might be beneficial for ruminants in case of reduced N intake due to enhanced urea concentrations in the tubular fluid leading to greater absorption rates of urea (Elfers et al, 2014).…”

Section: Discussionmentioning

confidence: 99%

“…For anti-NCX1 antibody, cross-reactivity with bovine tissue was reported by the manufacturer. Immunoblot assays detecting the expression of CaBP D28K , NaPi IIa, Na + /K + -ATPase, CaR, and PTHR proteins in caprine tissue were performed as described elsewhere (Muscher et al, 2008;Elfers et al, 2014Elfers et al, , 2015Herm et al, 2015).…”

Section: Semiquantification Of Trpv5 Cabp D28k Ncx1 Napi Iia Na mentioning

confidence: 99%

See 1 more Smart Citation

Modulation of renal calcium and phosphate transporting proteins by dietary nitrogen and/or calcium in young goats1

Firmenich¹,

Elfers²,

Wilkens³

et al. 2018

Journal of Animal Science

View full text Add to dashboard Cite

In young goats, a reduction in dietary nitrogen (N) had an impact on mineral homeostasis although ruminants are able to recycle N effectively due to rumino-hepatic circulation. A solitary calcium (Ca) reduction stimulated calcitriol synthesis and Ca concentrations remained unchanged, whereas a dietary N reduction led to a decrease in calcitriol, which could not be prevented by a simultaneous reduction of N and Ca. In a previous study, it was shown that a reduced dietary N intake caused a decrease in intestinal Ca absorption due to a reduction of intestinal Ca transporting proteins. As no data on the potential role of the kidneys are available, it was the aim of the present study to evaluate whether an N- and/or Ca-reduced diet had an impact on renal Ca and phosphate (Pi) transporting protein expression in young goats. The animals were divided into 4 feeding groups, each receiving an adequate N and Ca supply, a reduced N supply, a reduced Ca supply, or a combined N and Ca reduction for 6 to 9 wk. The protein expression of the renal Ca channel transient receptor potential cation channel subfamily V member 5 (TRPV5) was diminished in N-reduced fed goats (P = 0.03), whereas in Ca restricted animals, the expression remained unaltered. The mRNA and protein expression of the Ca-binding protein calbindin-D28K (CaBPD28K) and the sodium-Ca exchanger 1 (NCX1) were significantly decreased due to the N-reduced feeding (mRNA, P = 0.003; P < 0.0001; protein, P = 0.002; P = 0.02), whereas dietary Ca reduction increased the CaBPD28K and NCX1 mRNA expression (P = 0.05; P = 0.01). The mRNA and protein expression of the parathyroid hormone receptor (PTHR) decreased due to the N-reduced feeding (P = 0.02; P = 0.03). These results confirm that a reduced dietary N intake led to decreased TRPV5, CaBPD28K, PTHR, and NCX1 expression levels, contributing to low levels of calcitriol and plasma Ca. In contrast to this, sodium-phosphate cotransporter type IIa expression and plasma Pi concentration were increased during dietary N reduction, thus indicating that Pi homeostasis is modulated in a calcitriol-independent manner. In conclusion, the modulation of Ca transporting proteins expression in the kidney is not able to prevent changes in mineral homeostasis in young goats receiving an N-reduced diet.

show abstract

“…The group with uNH 4 + excretion ≥20 mEq/day had the largest daily protein intake and was predominantly men; both variables are associated with increased uNH 4 + excretion. While the authors indicate that the correlation of low uNH 4 + with the incident acidosis is independent of gender and amount of protein consumption, it should be noted that higher protein intake is associated with increased urine output due to enhanced NH 4 + production and the downregulation of AQP2 [54][55][56]. We have not been provided with the urine osmolality or the urine pH in the 3 different categories of uNH 4 + .…”

Section: Doi: 101159/000481892mentioning

confidence: 99%

Urine Ammonium, Metabolic Acidosis and Progression of Chronic Kidney Disease

Pourafshar

Soleimani

2017

Nephron

View full text Add to dashboard Cite

The metabolism of a typical Western diet generates 50-100 mEq of acid (H + ) per day, which must be excreted in the urine for the systemic acid-base to remain in balance. The 2 major mechanisms that are responsible for the renal elimination of daily acid under normal conditions are ammonium (NH 4 + ) excretion and titratable acidity. In the presence of systemic acidosis, ammonium excretion is intensified and becomes the crucial mechanism for the elimination of acid. The impairment in NH 4 + excretion is therefore associated with reduced acid excretion, which causes excess accumulation of acid in the body and consequently results in metabolic acidosis. Chronic kidney disease (CKD) is associated with the impairment in acid excretion and precipitation of metabolic acidosis, which has an adverse effect on the progression of CKD. Recent studies suggest that the progressive decline in renal ammonium excretion in CKD is an important determinant of the ensuing systemic metabolic acidosis and is an independent factor for predicting the worsening of kidney function. While these studies have been primarily performed in hypertensive individuals with CKD, a closer look at renal NH 4 + excretion in non-hypertensive individuals with CKD is warranted to ascertain its role in the progression of kidney disease.

show abstract

Modulation of aquaporin 2 expression in the kidney of young goats by changes in nitrogen intake

Cited by 14 publications

References 49 publications

Modulation of intestinal calcium and phosphate transport in young goats fed a nitrogen- and/or calcium-reduced diet

Modulation of intestinal calcium and phosphate transport in young goats fed a nitrogen- and/or calcium-reduced diet

Modulation of renal calcium and phosphate transporting proteins by dietary nitrogen and/or calcium in young goats1

Urine Ammonium, Metabolic Acidosis and Progression of Chronic Kidney Disease

Contact Info

Product

Resources

About