Modulation of influenza A virus replication by microRNA‐9 through targeting MCPIP1

Abstract

MicroRNAs (miRNAs), a family of small non-coding RNAs controlling translation and transcription of its target genes, play important roles in the regulation of various biological processes, including viral infection. Influenza A viruses (IAV) infection alters expression of cellular miRNAs, which in turn can modify the cellular environment to facilitate efficient virus replication. In this study, we showed that IAV infection significantly induced miR-9 expression in A549 cells, which occurred earlier than drastic expression of viral matrix (M) and nucleoprotein (NP) genes. Overexpression of miR-9 enhanced viral gene expression and production of infectious progeny, while knockdown of miR-9 significantly inhibited IAV replication in A549 cells. Recent studies have revealed antiviral potential of monocyte chemoattractant protein 1-induced protein 1 (MCPIP1), a PIN-like RNase capable of targeting and degrading viral RNA. Subsequently, we comprehensively confirmed that MCPIP1 functionally inhibited viral M and NP genes expression and progeny production, and also was regulated by miR-9 in A549 cells. Furthermore, MCPIP1 overexpression abrogated miR-9-induced IAV replication. Taken together, our findings indicate a new role of miR-9 induction in IAV infection and suggest IAV may hijack cellular miR-9 to benefit the viral life cycle. J. Med. Virol. 89:41-48, 2017. © 2016 Wiley Periodicals, Inc.

Effect of Human Coronavirus OC43 Structural and Accessory Proteins on the Transcriptional Activation of Antiviral Response Elements

“…Unfortunately, the authors did not show results for NF-κB-RE activation after 6 h of TNF-α treatment, the optimal time for NF-κB-RE activation in our experiments. The influenza A virus that is known to inhibit IRF3, AP-1, and NF-κB activation [35,36] was shown to upregulate the miRNA 9 expression [37]. We speculate that the expression of N protein results in transient downregulation of NF-κB expression through downregulation of its mediators (e.g., TLR7, MYD88, TRADD), leading to early inhibition of NF-ΚB-RE activation, and that the accumulation of miRNA9 in cells with time will lead to the formation of N protein/miRNA 9 complex and the removal of inhibition on NF-KB and NF-KB-RE.…”

MCPIP1 attenuates the innate immune response to influenza A virus by suppressing RIG‐I expression in lung epithelial cells

“…MCPIP1 plays important roles in suppressing virus replication and negatively regulating the cellular inflammatory response. Its expression is not only rapidly induced by proinflammatory molecules such as TNF‐α, MCP‐1, IL‐1β, and LPS, but also by viral infection . MCPIP1 is ubiquitously expressed in various epithelial cells and unexpectedly higher protein levels of MCPIP1 in epithelial cells than in myeloid cells, implying that MCPIP‐1 as a regulator of the immune response may be functionally important in epithelial cells.…”

“…Its expression is not only rapidly induced by proinflammatory molecules such as TNF-α, MCP-1, IL-1β, and LPS, 12,18 but also by viral infection. 15,16,19 MCPIP1 is ubiquitously expressed in various epithelial cells and unexpectedly higher protein levels of MCPIP1 in epithelial cells than in myeloid cells, 28 implying that MCPIP-1 as a regulator of the immune response may be functionally important in epithelial cells. We were encouraged by these results to investigate the role of virus-induced MCPIP1 in the course of IAV infection.…”

“…The relative changes in gene expression were calculated by 2 −ΔΔCT method . The primer sequences for GAPDH and IFNβ have been described previously . RIG‐I primer's sequences are as follow: forward 5′‐ AGAGCACTTGTGGACGCTTT‐3′ and reverse 5′‐AGCAACTGAGGTGGCAATCA‐3′.…”

“…[12][13][14][15][16][17] The DUB activity of MCPIP1 can inhibit JNK and NF-κB signaling by removing ubiquitin moieties from tumor necrosis factor receptor-associated factor (TRAF) family, including TRAF2, TRAF3, and TRAF6. 18 Because of upregulation of MCPIP1 expression in response to infection with several viruses such as IAV, hepatitis C virus (HCV), dengue virus (DEN), and japanese encephalitis virus (JEV), 15,16,19 we propose that MCPIP1 should be engaged in the regulation of innate immunity induced by viruses or its componets.…”