Modulation of the Contact Hypersensitivity Response by Æ-941 (Neovastat), a Novel Antiangiogenic Agent

Dupont, Éric; Wang, B.; Mamelak, Adam J.; Howell, Brandon G.; Shivji, Gulnar M.; Zhuang, Lin; Dimitriadou, Violetta; Falardeau, Pierre; Sauder, Daniel N.

doi:10.1177/120347540300700304

Cited by 5 publications

(7 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The drug is highly efficient in preventing hapten sensitization in animal models, but does not affect the expression of the allergic reaction in already sensitized animals, thus suggesting that the magnitude of the inflammatory response is independent from local T cell expansion [48]. Similar results were obtained with the angiogenesis inhibitor AE-941 (Neovastat), which dampened the immune reaction only when administered in the sensitization phase of CHS [49].…”

Section: Current and Future Approach For Manage-ment Of Acdsupporting

confidence: 78%

Allergic Contact Dermatitis: Novel Mechanisms and Therapeutic Perspectives

Cavani¹,

Luca

2010

CDM

View full text Add to dashboard Cite

Allergic contact dermatitis is a common eczematous skin disease that occurs in sensitized individuals at the site of contact with small chemicals penetrating the skin barrier. The onset of the disease is mostly due to the rapid recruitment of chemical-specific CD8+ T cells, which induce apoptosis of keratinocytes. Additionally, CD4+ Th1 and Th17 contribute to the extension of the inflammatory reaction by releasing pro-inflammatory cytokines that activate keratinocytes and other skin resident cells. The immune reaction is tightly regulated through multiple mechanisms. In particular, T cell population with regulatory function, such as T regulatory cells 1 and CD4+CD25+ T regulatory cells have a critical role in preventing the development of allergic reactions to innocuous chemicals contacting the skin, and in limiting the magnitude of the inflammatory process in already sensitized individuals. Allergic contact dermatitis is a chronic disease, which lasts, in most cases, for the entire life of the affected individual. Thus, prevention and avoidance of contact with the sensitizer are critical factors in the management of affected patients. The gold standard therapeutic approach for the disease remains the local and/or systemic immunosuppression, aimed to block T cell functions and keratinocyte responsiveness to pro-inflammatory stimuli. However, alternative approaches that aim at preventing T cell accumulation in peripheral tissues are under investigation. Most recently, disclosure of mechanisms regulating allergic contact dermatitis have provided new therapeutic perspectives for the disease, mostly based on immunomodulatory interventions, as in the case of induction of specific oral tolerance to the causative allergen.

show abstract

Section: Current and Future Approach For Manage-ment Of Acdsupporting

confidence: 78%

Allergic Contact Dermatitis: Novel Mechanisms and Therapeutic Perspectives

Cavani¹,

Luca

2010

CDM

View full text Add to dashboard Cite

show abstract

“…The promoter and coding regions of the NDUFA1 gene were sequenced by using genomic DNA isolated from the same BCC and patient‐matched normal skins described above. DNA amplification was performed by means of PCR as previously described (16). The primers used for DNA target amplification and sequencing were: 5′‐AAAGCCGCCTTCTGTTTACC‐3′ (forward), 5′‐TGGATGTACGCAGTAGCCAG‐3′ (reverse) for promoter and exon 1; 5′‐GTCACAGGTACCAACTTAATCC‐3′, 5′‐TCATTTTGGGTATCACTGGAGTCT‐3′ (forward), 5′‐CAGGCAAAGGATATAGGC‐3′, 5′‐GACTCCAGTGATACCCAAAATGAG‐3′ (reverse) for exon 2; 5′‐ATGTGGGATGTGGAAGCACTCT‐3′, 5′‐CAATGCCATTTAATGACACTGGAA‐3′ (forward), 5′‐GGGTAGATGGCCATAACTGAG‐3′, 5′‐AAGACTACATTGGGTAGATTGCTTGATTT‐3′ (reverse) for exon 3 (Invitrogen Canada Inc., Burlington, ON, Canada).…”

Section: Methodsmentioning

confidence: 99%

“…The promoter and coding regions of the NDUFA1 gene were sequenced by using genomic DNA isolated from the same BCC and patient-matched normal skins described above. DNA amplification was performed by means of PCR as previously described (16). The primers used for DNA target amplification and sequencing were: 5 0 -AAAGCCGCCTTCTGTT-TACC-3 0 (forward), 5 0 -TGGATGTACGCAGTAGCCAG-3 0 (reverse) for promoter and exon 1; In contrast to other microarray analysis approaches that view heterogeneity primarily as a result of background noise, the CAM method considers it as part of the underlying disease mechanism and thus, incorporates such heterogeneity into the analysis.…”

Section: Ndufa1 Sequence Analysismentioning

confidence: 99%

Downregulation of NDUFA1 and other oxidative phosphorylation‐related genes is a consistent feature of basal cell carcinoma

Mamelak

Kowalski

Murphy

et al. 2005

Experimental Dermatology

View full text Add to dashboard Cite

Basal cell carcinoma (BCC) is the most common cutaneous malignancy that, like other tumours, possesses a heterogeneous genetic composition. In order to select genes with consistent changes in expression among these tumours, we analysed BCC microarray expression data by using a novel approach, termed correlative analysis of microarrays (CAM). CAM is a nested, non-parametric method designed to qualitatively select candidates based on their individual, similar effects upon an array-wide closeness measure. We applied the CAM method to expression data generated by two-channel cDNA microarray experiments, where 21 BCC and patient-matched normal skin specimens were examined. Fifteen candidate genes were selected, with six overexpressed and nine underexpressed in BCC vs. normal skin. Five of the nine consistently downregulated genes in the tumour samples are involved in mitochondrial function and the oxidative phosphorylation (OXPHOS) pathway. One of these genes was the 7.5-kDa subunit, NADH dehydrogenase (ubiquinone) alpha subcomplex-1 (NDUFA1), an accessory component of OXPHOS complex-I that is essential for respiratory activity. These findings support the hypothesis that irregularities in mitochondrial function are involved in neoplasia. Suppression of NDUFA1 expression could represent a key pathogenic mechanism in the development of BCC.

show abstract

“…Neovastat blocks two main mechanisms of angiogenesis activation, VEGF and matrix metalloproteinase (MMP)-2 and MMP-9. At the molecular level, Neovastat was shown to compete against the binding of VEGF to its receptor in endothelial cells and significantly inhibited the VEGF-dependent tyrosine phosphorylation of KDR, whereas it had no significant effect on Flt1 activity (274)(275)(276)(277)(278). Moreover, the inhibition of receptor phosphorylation was correlated with a marked decrease in the ability of VEGF to induce pERK activation (274).…”

Section: Neovastat (Ae941)mentioning

confidence: 99%

Development of angiogenesis inhibitors to vascular endothelial growth factor receptor 2. current status and future perspective

Paz¹,

Zhu²

2005

Front Biosci

View full text Add to dashboard Cite

Angiogenesis, the recruitment of new blood vessels is a crucial mechanism required for both tumor growth and metastasis. Advances in the understanding of the molecular mechanisms underlying the angiogenesis process have led to the discovery of a variety of pharmaceutical agents with antiangiogenic activity. The potential application of these angiogenesis inhibitors is currently under intense clinical investigation. Decades of investigation suggest that vascular endothelial growth factor (VEGF) and its receptors, particularly VEGF receptor 2 (VEGFR2, or kinase insert domain-containing receptor, KDR), play a critical role in tumor-associated angiogenesis. KDR, therefore, represents a good target for therapeutic intervention. A number of agents designed selectively for targeting KDR are being evaluated in various phases of clinical trials in cancer patients. This manuscript reviews briefly the biology of VEGF family of ligands and receptors and of KDR in particular. The attempts to develop effective KDR antagonists, including small molecules, antibodies and others, for therapeutic purposes are discussed comprehensively with special emphasis on tumor angiogenesis.

show abstract

Modulation of the Contact Hypersensitivity Response by Æ-941 (Neovastat), a Novel Antiangiogenic Agent

Abstract: Antiinflammatory effects of Neovastat observed in CHS could be linked to modulation of cytokines early in the sensitization phase.

Cited by 5 publications

References 29 publications

Allergic Contact Dermatitis: Novel Mechanisms and Therapeutic Perspectives

Allergic Contact Dermatitis: Novel Mechanisms and Therapeutic Perspectives

Downregulation of NDUFA1 and other oxidative phosphorylation‐related genes is a consistent feature of basal cell carcinoma

Development of angiogenesis inhibitors to vascular endothelial growth factor receptor 2. current status and future perspective

Contact Info

Product

Resources

About