Modulatory effect of lipopolysaccharide on immune‐related gene expression and serum protein fractionation in grey mullet,Mugil cephalus

Abstract

Immunity occupies the top priority in aquaculture. Great efforts have been made to study fish immunity, but little is known about the immunity of grey mullet, Mugil cephalus despite of its importance. We evaluated the effect of different doses (0, 1, 10 and 100 µg/kg body weight) of lipopolysaccharide (LPS) on the expression of non‐specific immune response genes (interleukin (il) 1β, il8, il10 and tumour necrosis factor alpha (tnfα)) in the liver, as well as its effect on the fractionation of serum protein in juvenile grey mullet along different times and concentrations. Analysis revealed that LPS initially caused an upregulation in the studied cytokines. After that, transcripts levels were switched sequentially between downregulation and upregulation, ending with an upregulation at 1 week post injection in il8, il10 and tnfα. Regarding il1β, its initial upregulation was followed by gradual decreases, which reached a marked downregulation at 1 week post injection. Protein fractionation exhibited many changes among doses and time. Nine fractions were discernable in protein electrophoresis of serum in all doses. The most pronounced changes were detected in fractions 7–9 (generally refer to γ globulins or immunoglobulins) using densitometric analysis. In addition, LPS suggested to modulate the levels of serum transferrin. It is known that LPS is a component of the cell wall of Gram negative bacteria, and this study sheds light on the molecular fitness mechanisms against bacterial infection, which could help in developing a strategy to improve resistance to bacterial diseases, or possibly to enhance immune response in grey mullet.

RNA Interference in Aquaculture: A Small Tool for Big Potential

“…This system can take months to provide a full response. The innate immune system has a smaller number of receptors that respond more rapidly to known but potentially foreign molecules. ,− The innate immune system can recognize foreign DNA containing unmethylated CpG motifs via Toll-like receptor (TLR) 9 and foreign RNA via multiple receptors, such as TLRs 3, 7, and 8, retinoic acid-inducible gene I, melanoma differentiation-associated protein 5, protein kinase R, or oligoadenylate synthase. , TLRs7/8 recognize single-stranded RNA, and TLR3 recognizes dsRNA. The three receptors can bind siRNAs.…”

Ergasilus extensusand bacterial co‐infection in flathead grey mullet,Mugil cephalus(Linnaeus, 1758), are associated with pathological changes and immunological gene expression alterations

“…Then, cDNA was transcribed from RNA using a cDNA synthesis kit (SensiFAST; Bioline) following manufacturer's instructions. Synthesized cDNA was processed using M. cephalus specific PCR primer sets for TNFα and IL-1β, according to Byadgi et al, (2016) and Abdel-Mageid et al, (2020). Primers were as follows: IL-1β forward: GAGGAGCTTGGTGCAGAACA and reverse: CTTTGTTCGTCACCTCCTCCA) and TNFα forward: GCG CAGTCTGTCATTGGTT and reverse: ACTGGACACGCTCACTGTAG TG.…”

Exploring the role of microRNAs in axolotl regeneration

“…The immune system plays an essential and effective role in the regeneration process. There is a strong link between antioxidant defense machinery and immune systems (Abdel‐Mageid, Zaki, El Senosi, El Asely et al, 2020; Abdel‐Mageid, Zaki, El Senosi, Fahmy et al, 2020; Abo‐Al‐Ela, 2018a, 2018b, 2019a). Signaling of reactive oxygen species (ROS) after axolotl tail amputation is required for early phases of regeneration.…”