Molecular and cellular mechanisms underlying iron transport deficiency in microcytic anemia

Touret, Nicolas; Martín‐Orozco, Natalia; Paroutis, Paul; Furuya, Wendy; Lam-Yuk-Tseung, Steven; Forbes, John; Gros, Philippe; Grinstein, Sergio

doi:10.1182/blood-2004-02-0731

Cited by 42 publications

(45 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Lanes 1, 5, and 9 are from mononuclear cells; lanes 2, 6, and 10 are from granulocytes; lanes 3, 7, and 11 are from platelets; lanes 4, 8, and 12 are from reticulocytes. al, 18 who demonstrated that when the DMT1 G185R mutant is stably expressed in cell lines it is abnormally glycosylated, less stable, and less active in metal transport. If present in detectable amounts in cells, the protein product of the exon 12-deleted mRNA does not appear to have a deleterious effect on iron absorption or utilization, as the patient's sister, who is a heterozygote and has a significant amount of the exon-deleted message, has no evidence of abnormal iron metabolism.…”

Section: Discussionmentioning

confidence: 99%

Identification of a human mutation of DMT1 in a patient with microcytic anemia and iron overload

Mims

Guan

Pospı́šilová

et al. 2005

Blood

204

126

View full text Add to dashboard Cite

Divalent metal transporter 1 (DMT1) is a transmembrane protein crucial for duodenal iron absorption and erythroid iron transport. DMT1 function has been elucidated largely in studies of the mk mouse and the Belgrade rat, which have an identical single nucleotide mutation of this gene that affects protein processing, stability, and function. These animals exhibit hypochromic microcytic anemia due to impaired intestinal iron absorption, and defective iron utilization in red cell precursors. We report here the first human mutation of DMT1 identified in a female with severe hypochromic microcytic anemia and iron overload. This homozygous mutation in the ultimate nucleotide of exon 12 codes for a conservative E399D amino acid substitution; however, its predominant effect is preferential skipping of exon 12 during processing of pre-messenger RNA (mRNA). The lack of fulllength mRNA would predict deficient iron absorption in the intestine and deficient iron utilization in erythroid precursors; however, unlike the animal models of DMT1 mutation, the patient is iron overloaded. This does not appear to be due to up-regulation of total DMT1 mRNA. DMT1 protein is easily detectable by immunoblotting in the patient's duodenum, but it is unclear whether the protein is properly processed or targeted. IntroductionThe last 5 years have been marked by an explosion of knowledge in the field of iron metabolism. These discoveries include identification of the proteins involved in iron absorption and trafficking; discovery of a small peptide, hepcidin, which appears to regulate iron uptake; and elucidation of the role of iron in gene expression. One of the newly identified proteins is divalent metal transporter 1 (DMT1), which is expressed at the brush border of enterocytes in the proximal duodenum where it is presumed to mediate pHdependent uptake of ferrous iron from the gut lumen. 1,2 In the erythroblast, the protein is present in the endosomal membrane, where it appears to function in transport of iron released from the transferrin-receptor complex toward the mitochondria, site of heme synthesis, 3 via a pathway that remains to be defined. In rodent models, mutation of a single nucleotide results in substitution of Arg for Gly at position 185 (G185R) of the DMT1 gene and leads to hypochromic/microcytic anemia and iron deficiency. 4,5 The predicted structure of the protein includes 12 transmembrane domains, asparagine-linked glycosylation signals in an extracytoplasmic loop, membrane targeting motifs, and a consensus transport motif that is common to homologous cation transport proteins found in other species. 6,7 Four major mammalian DMT1 isoforms, resulting from alternative splicing at the 5Ј and 3Ј ends of pre-messenger RNA (mRNA) are known. 8 Isoform I has an iron responsive element (IRE) in the 3Ј untranslated region, whereas isoform II lacks the IRE, and the C-terminal 18 amino acids are replaced by a novel 25-amino acid segment. 6 The duodenum expresses primarily isoform I, whereas erythroblasts express chiefly isoform II; o...

show abstract

Section: Discussionmentioning

confidence: 99%

Identification of a human mutation of DMT1 in a patient with microcytic anemia and iron overload

Mims

Guan

Pospı́šilová

et al. 2005

Blood

204

126

View full text Add to dashboard Cite

show abstract

“…Microcytic anemia (mk) mice and Belgrade (b) rats have systemic iron deficiency and anemia attributable to the same spontaneous missense mutation (G185R) in Slc11a2 (13,14). The mutation impairs both subcellular localization (15) and transport activity (16,17). We discovered that it also confers a novel calcium channel-like activity of uncertain importance (18).…”

Section: Introductionmentioning

confidence: 90%

Slc11a2 is required for intestinal iron absorption and erythropoiesis but dispensable in placenta and liver

Gunshin¹,

Fujiwara²,

Custodio³

et al. 2005

J. Clin. Invest.

351

136

View full text Add to dashboard Cite

Solute carrier family 11, member 2 (SLC11A2) is the only transmembrane iron transporter known to be involved in cellular iron uptake. It is widely expressed and has been postulated to play important roles in intestinal iron absorption, erythroid iron utilization, hepatic iron accumulation, placental iron transfer, and other processes. Previous studies have suggested that other transporters might exist, but their physiological significance remained uncertain. To define the activities of Slc11a2 in vivo, we inactivated the murine gene that encodes it globally and selectively. We found that fetal Slc11a2 is not needed for materno-fetal iron transfer but that Slc11a2 activity is essential for intestinal non-heme iron absorption after birth. Slc11a2 is also required for normal hemoglobin production during the development of erythroid precursors. However, hepatocytes and most other cells must have an alternative, as-yet-unknown, iron uptake mechanism. We previously showed that Slc11a2 serves as the primary portal for intestinal iron entry in hemochromatosis. However, inactivation of murine Hfe ameliorates the phenotype of animals lacking Slc11a2.

show abstract

“…6,12 The human DMT1 cDNA (non-IRE isoform, generous gift from Dr J. T. Prchal, Baylor College of Medicine, Houston, TX) was tagged by C-terminal HA epitope and inserted into the expression plasmid pcDNA3.1(Ϫ) (Invitrogen, Burlington, Canada). Site-directed mutagenesis was performed using the QuikChange and ExSite kits (Stratagene, La Jolla, CA) and allele-specific oligonucleotides: 5ЈGGCCAGTTTGTCATG-GACGGATTCCTGAACCTA3Ј, 5ЈTAGGTTCAGGAATCCGTCCATGA-CAAACTGGCC3Ј to create E399D DMT1; 5ЈCCCTTTGTAGATGTCCA-CAGCCAGTGT3Ј, 5ЈGGATTCCTGAACCTAAAGTGGTCACGCЈ3 to create DEL DMT1.…”

Section: Cell Culture and Transfectionmentioning

confidence: 99%

“…3 DMT1 is an integral membrane protein composed of 12 predicted transmembrane domains (TM) and containing 2 putative glycosylation sites in an extracytoplasmic loop, membrane targeting motifs, and a consensus transport motif. 4,5 Recently, Touret et al 6 demonstrated that the G185R DMT1 mutant protein found in microcytic anemia (mk) mice 7 and the Belgrade (b) rats 8 is abnormally processed, less stable, and displays decreased transport activity. We previously reported a Czech female with severe hypochromic microcytic anemia and iron overload caused by a homozygous mutation in the DMT1 gene (1285G Ͼ C) that changes Glu 399 to Asp (E399D).…”

Section: Introductionmentioning

confidence: 99%

Functional consequences of the human DMT1 (SLC11A2) mutation on protein expression and iron uptake

Priwitzerova

Nie

Sheftel

et al. 2005

Blood

View full text Add to dashboard Cite

We have previously described a case of severe hypochromic microcytic anemia caused by a homozygous mutation in the divalent metal transporter 1 (DMT1 1285G > C). This mutation encodes for an amino acid substitution (E399D) and causes preferential skipping of exon 12 during processing of the DMT1 mRNA. To examine the functional consequences of this mutation, full-length DMT1 transcript with the patient's point mutation or a DMT1 transcript with exon 12 deleted was expressed in Chinese hamster ovary (CHO) cells. Our results demonstrate that the E399D substitution has no effect on protein expression and function. In contrast, deletion of exon 12 led to a decreased expression of the protein and disruption of its subcellular localization and iron uptake activity. We hypothesize that the residual protein in hematopoietic cells represents the functional E399D DMT1 variant, but because of its quantitative reduction, the iron uptake activity of DMT1 in the patient's erythroid cells is severely suppressed. (Blood. 2005;106: 3985-3987)

show abstract

Molecular and cellular mechanisms underlying iron transport deficiency in microcytic anemia

Cited by 42 publications

References 23 publications

Identification of a human mutation of DMT1 in a patient with microcytic anemia and iron overload

Identification of a human mutation of DMT1 in a patient with microcytic anemia and iron overload

Slc11a2 is required for intestinal iron absorption and erythropoiesis but dispensable in placenta and liver

Functional consequences of the human DMT1 (SLC11A2) mutation on protein expression and iron uptake

Contact Info

Product

Resources

About