Molecular Biologic Techniques in Cytopathologic Diagnosis

Abstract

Molecular diagnosis is an application of the knowledge on molecular mechanisms of disease to diagnosis, therapeutic decision-making, and prognostication. Basically any molecular diagnostic technique could be used in molecular diagnostic cytopathology. Currently applicable molecular techniques in the cytopathology field include PCR based molecular techniques (SSCP, DHPLC, RFLP, LOH, MSI, RT-PCR, QRT-PCR, allele-specific PCR, sequencing, and methylation analysis), FISH, cDNA microarray, aCGH, and reverse-phase protein microarray, etc. Exfoliative cytology as well as fine needle aspiration cytology specimen can be used for analysis. In order to obtain a successful result, collection of target cells without contamination of the blood cells, inflammatory cells including histiocytes, and stromal cells, and a good DNA yield are most important. Molecular diagosis finds its full meaning when interpreted by those who can combine the clinical background of the disease with morphological, immunocytochemical, and molecular diagnostic results. Therefore, these assays would fulfill their full potential when interpreted by the cytopathologists.

Clinical significance of EGFR mutation types in lung adenocarcinoma: A multi-centre Korean study

“…DNA extraction buffer solution (50 mM Tris buffer, pH 8.3, 1 mM EDTA, pH 8.0, 5% Tween-20, and 100 μg/mL proteinase K) with 10% resin (20-50 μL) was added to the scraped cells. After incubation at 56˚C for at least 1 hour, each tube was heated to 100˚C for 20 minutes (min) followed by centrifugation at 12,000 rpm for 10 min at 4˚C to pellet the debris [27]. EGFR mutation testing.…”

Detection and comparison of peptide nucleic acid-mediated real-time polymerase chain reaction clamping and direct gene sequencing for epidermal growth factor receptor mutations in patients with non-small cell lung cancer

“…Then, 50-100 L DNA extraction buffer solution (50 mM Tris buffer, pH 8.3, 1 mM EDTA, pH 8.0, 5% Tween-20, and 200 g/mL proteinase K) with 10% resin was added to the scraped cells. After incubation at 56 • C for at least 1 h, each tube was heated to 100 • C for 20 min followed by centrifugation at 12,000 rpm for 10 min at 4 • C to pellet the debris [10,11]. The recovered supernatant was used for the PCR reaction.…”

Efficiency of EGFR mutation analysis for small microdissected cytological specimens using multitech DNA extraction solution

“…The DNA in the denaturation solution was separated, and the templates were washed with washing buffer, transferred to a PSQ 96 SNP plate, and annealed in the annealing buffer at room temperature with the following sequencing primers: exon 18 E709K, 5′TGATCTTTTTGAATTCAGTT‐3′, G719A and G719S 5′‐CCGAACGCACCGGAG‐3′; exon 19 deletion, 5′‐ATTCCCGTCGCTATC‐3′; exon 20 T790M, 5′‐GATGCCCAGCAGGCG‐3′; and exon 21 L858R and A859T, 5′‐AAGATCACAGATTTTGG‐3′. Finally, specimens were analyzed using a PyroMark ID System (Qiagen) with the SNP reagent kit for sequencing . EGFR mutation analysis was performed in 3 samples from each group containing similar numbers of cells (25, 50, 100, 200, 300, or 500).…”

“…Finally, specimens were analyzed using a PyroMark ID System (Qiagen) with the SNP reagent kit for sequencing. 15,16 EGFR mutation analysis was performed in 3 samples from each group containing similar numbers of cells (25,50,100,200, 300, or 500).…”