Molecular characterization and sequence analyses of Banana bunchy top virus infecting banana cultivar Jahaji (Dwarf Cavendish) in Assam, India

Baldodiya, Gajendra Mohan; Baruah, Geetanjali; Borah, Bibha Chetia; Modi, Mahendra Kumar; Nath, Palash Deb

doi:10.1007/s13205-019-1636-5

Cited by 7 publications

(3 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This categorization was later modi ed into two different groups, viz. the Paci c Indian Ocean (PIO) and the South East Asian (SEA) groups based on their geographical delineation [4].…”

Section: Introductionmentioning

confidence: 99%

Monitoring the distribution of banana bunchy top virus in South Africa: a country-wide survey

et al. 2022

View full text Add to dashboard Cite

Banana bunchy top disease (BBTD) is the most devastating viral disease of bananas worldwide and is caused by the banana bunchy top virus (BBTV). The disease is spread by the banana aphid Pentalonia nigronervosa Coquerel (Hemiptera: Aphididae) and through infected propagation material. In 2015, the virus was detected in an isolated area in the South Coast region of the KwaZulu-Natal Province (KZN), South Africa. The aim of this study was to conduct surveys across three banana-producing regions in South Africa, viz. KwaZulu-Natal, Mpumalanga and Limpopo provinces. Over 1700 plant and aphid samples were collected from commercial farms and rural households in the three provinces and more intense sampling was done in the affected KZN region. A BBTV-speci c polymerase chain reaction (PCR), targeting the putative replicase gene, was performed to detect virus-infected samples. The amplicons that yielded an expected band size of 349 bp, were sequenced. Comparative phylogenetic analyses showed that the South African BBTV isolates clustered within the Paci c Indian Ocean genomic group that included isolates from India and other regions in Africa with a bootstrap value of 94% . To date, the virus has been identi ed only in the South Coast region of the KwaZulu-Natal province. Intense management strategies, including scouting, removal of infected plants and control of aphids, have been implemented in areas where positive samples were identi ed to minimize the spread of the virus. Findings from this study emphasize the need to continue monitoring and containing the spread in the KZN South Coast region.

show abstract

“…This categorization was later modi ed into two different groups, viz. the Paci c Indian Ocean (PIO) and the South East Asian (SEA) groups based on their geographical delineation [4].…”

Section: Introductionmentioning

confidence: 99%

Monitoring the distribution of banana bunchy top virus in South Africa: a country-wide survey

et al. 2022

View full text Add to dashboard Cite

show abstract

“…The LAMP assay takes advantage of high strand displacement activity of nuclease-free water and stored at -20 before testing. The forty test samples along with one healthy sample were subjected to a conventional PCR for confirmation using a set of standard primer that amplifies a region of the coat protein in DNA3 of BBTV genome (Kakati and Nath, 2018;Baldodiya et al, 2019). PCR primers used were: BBTV-DNA3 forward primer (5' ATCAAGAAGAGGCGGGTTGG 3') and BBTV-DNA3 reverse primer (5' GGATTTCTTCGGA TACCTAGCCAT 3').…”

Section: Resultsmentioning

confidence: 99%

Real-Time loop-mediated isothermal amplification assay for rapid detection of Banana bunchy top virus in North-east India

Kaushik¹,

Halabi²,

Barua³

et al. 2022

JEB

View full text Add to dashboard Cite

Aim: The study aims to standardize a Real-Time LAMP assay for effective, highly sensitive, and rapid detection of BBTV in North-east India. Methodology: Forty samples of banana showing BBTV like symptoms were collected from Assam, India and subjected to conventional PCR for confirmation. Six sets of BBTV LAMP primers were designed and the PCR positive samples were subjected to Real-Time LAMP assay for detection of BBTV. Finally, a sensitivity test of BBTV LAMP assay and comparison of BBTV LAMP assay with conventional PCR was done using seven 10-fold dilutions of total genomic DNA of leaf samples with the highest dilution starting from 100 ng µl-1. Results: Initially a total of twenty six out of forty banana samples were tested positive for BBTV with conventional PCR method. The Real-Time LAMP assay for BBTV detection resulted in typical sigmoidal amplification curves with the peak values ranging between 8.00 to 12.15 min and annealing derivatives ranging between 83.3oC to 84.3oC in the tested samples. Sensitivity testing and comparison of BBTV Real-Time LAMP assay with conventional PCR revealed that the BBTV LAMP assay could efficiently detect up to 0.0001ng µl-1 of total DNA against 0.01ng µl-1 in conventional PCR. Interpretation: The findings highlight rapid, sensitive, accurate and effective diagnosis of BBTV using Real-Time LAMP method. This method can be preferred over conventional diagnostic techniques like PCR or ELISA for rapid large scale detection of BBTV in banana plants in North-east India. Key words: Banana, Banana bunchy top virus, Rapid detection, Real-Time LAMP assay

show abstract

“…In viruses, recombination breakpoints identification is a useful way to detect circulating recombinant forms and to infer the underlying recombination mechanisms such as intra and intergenomic recombination [ 23 , 24 ]. Although sequence analysis of individual BBTV components [ 9 , 10 , 15 , 16 , 25 – 30 ] and complete BBTV genomes [ 31 – 36 ] revealed evidence of intra and intergenomic recombination, but no study related to the understanding the contribution of these recombination mechanisms in genetic diversity has been reported so far for BBTV. Previous molecular analysis of BBTV from Pakistan has been very limited with only one partial genome [ 37 ] and a few DNA components [ 16 , 25 , 37 ] have been sequenced from different districts of Sindh province.…”

Section: Introductionmentioning

confidence: 99%

Banana bunchy top virus genetic diversity in Pakistan and association of diversity with recombination in its genomes

Bashir

Naqvi

Muhammad³

et al. 2022

PLoS ONE

View full text Add to dashboard Cite

Banana Bunchy top virus (BBTV) is a multipartite circular single strand DNA virus that belongs to genus Babuvirus and family Nanoviridae. It causes significant crop losses worldwide and also in Pakistan. BBTV is present in Pakistan since 1988 however, till now only few (about twenty only) sequence of genomic components have been reported from the country. To have insights into current genetic diversity in Pakistan fifty-seven genomic components including five complete genomes (comprises of DNA-R, -U3, -S, -M, -C and -N components) were sequenced in this study. The genetic diversity analysis of populations from Pakistan showed that DNA-R is highly conserved followed by DNA-N, whereas DNA-U3 is highly diverse with the most diverse Common Region Stem-loop (CR-SL) in BBTV genome, a functional region, which previously been reported to have undergone recombination in Pakistani population. A Maximum Likelihood (ML) phylogenetic analysis of entire genomes of isolates by using sequence of all the components concatenated together with the reported genomes around the world revealed deeper insights about the origin of the disease in Pakistan. A comparison of the genetic diversity of Pakistani and entire BBTV populations around the world indicates that there exists a correlation between genetic diversity and recombination. Population genetics analysis indicated that the degree of selection pressure differs depending on the area and genomic component. A detailed analysis of recombination across various components and functional regions suggested that recombination is closely associated with the functional parts of BBTV genome showing high genetic diversity. Both genetic diversity and recombination analyses suggest that the CR-SL is a recombination hotspot in all BBTV genomes and among the six components DNA-U3 is the only recombined component that has extensively undergone inter and intragenomic recombination. Diversity analysis of recombinant regions results on average one and half fold increase and, in some cases up to four-fold increase due to recombination. These results suggest that recombination is significantly contributing to the genetic diversity of BBTV populations around the world.

show abstract

Molecular characterization and sequence analyses of Banana bunchy top virus infecting banana cultivar Jahaji (Dwarf Cavendish) in Assam, India

Cited by 7 publications

References 25 publications

Monitoring the distribution of banana bunchy top virus in South Africa: a country-wide survey

Monitoring the distribution of banana bunchy top virus in South Africa: a country-wide survey

Real-Time loop-mediated isothermal amplification assay for rapid detection of Banana bunchy top virus in North-east India

Banana bunchy top virus genetic diversity in Pakistan and association of diversity with recombination in its genomes

Contact Info

Product

Resources

About