Molecular Characterization of Clistobothrium sp. Viable Plerocercoids in Fresh Longfin Inshore Squid (Doryteuthis pealeii) and Implications for Cephalopod Inspection

Abstract

Cephalopods, an appreciated seafood product, are common hosts of marine cestodes. The aim of this work is to report visible alive plerocercoids in longfin inshore squid (Doryteuthis pealeii), a cephalopod species commercialized as fresh and whole in Italy. Seventy D. pealeii from the Northwest Atlantic (FAO area 21) were collected and visually inspected. In total, 18 plerocercoid larvae were found in the viscera of 10 host specimens (P: 14.3% 95% CI 7.1–24.7; MI: 1.8, MA: 0.26; range 1–4) and molecularly analyzed targeting the variable D2 region of the large subunit (LSU) rRNA gene and the cytochrome c oxidase subunit I (COI) gene. The molecular characterization allowed to identify all the plerocercoids as Clistobothrium sp., a cestode of the Phyllobothriidae family with Lamnidae sharks as definitive hosts, and cephalopods as second intermediate hosts. These findings represent the first molecular record of Clistobothrium sp. in D. pealeii, thus contributing to elucidate its poorly known life cycle. Even if not affecting consumer’s health, these visible parasites may represent a reason for disgust for consumers. Therefore, the results suggest that Food Business Operators should also check for the presence of these visible parasites during inspection and underline the importance of a correct consumers’ education.

First molecular detection of the parasites Molicola uncinatus and Hepatoxylon trichiuri (Cestoda: Trypanorhyncha) infecting the silver scabbardfish Lepidopus caudatus from the Central Mediterranean Sea: Implications for the seafood quality and safety

“…The larval forms of Trypanorhyncha are generally found encysted in visceral organs and/or musculature of marine teleosts. Their occurrence in the muscles alters the fish flesh quality, reducing the marketability of commercially important fish species (Dias, Sao Clemente, Pinto, & Knoff, 2011;da Fonseca, de Sao Clemente, Felizardo, Gomes, & Knoff, 2012;Deardorff, Raybourne, & Mattis, 1984;Giarratana et al, 2014;Samn, Metwally, Zeina, & Khalaf Allah, 2014;Abdelsalam et al, 2016;Santoro et al, 2018;Oliveira, Kuraiem, Fonseca, Gomes, & Knoff, 2019;Guardone et al, 2020). Heavily infected fish fillets result unappealing to consumers; thus, the presence of these parasites causes economic loss to the fishing industry (Abdelsalam et al, 2016;Deardorff et al, 1984;Giarratana et al, 2014;Samn et al, 2014;Santoro et al, 2018).…”

Parasite assemblages in volatile host stocks: inter- and intra-cohort variability restrict their value as biological tags for squid stock assessment

“…Many studies on parasites of cephalopods are aged and reliant upon morphological features. Only recently, the implementation of molecular techniques began to more accurately elucidate the taxonomic status of cestode species parasitizing squids (Brickle et al ., 2001 ; Caira et al ., 2020 ; Guardone et al ., 2020 ), providing evidence of a potential overestimation of cestode species in I. argentinus and allowing proper comparisons for squid stock assessment.…”

First Report of Proteocephalus longicollis (Zeder, 1800) in Alosa fallax lacustris (Fatio, 1890) from Lake Garda (Italy): Morphological and Molecular Study

“…Genomic DNA was used to amplify the two molecular loci by polymerase chain reactions (PCR) using Taq DNA Polymerase Recombinant kit (Invitrogen, Carlsbad, CA, USA) and the following primer sets 5′AGTCGGGTTGTTTGAGAATG3′ and 5′CGTGTTTCAAGACGGGTC3′ for LSU rRNA [ 31 ] and 5′ATAGGTGTGTTGTATACGTTGATTGG3′ and 5′AAGCATCGTAATAGCAGC3′ for the ITS2 region. PCR reactions (50 μL total volume) were performed in an Ep-Gradient Mastercycler (Eppendorf, Hamburg, Germany) using the following cycling parameters for LSU rRNA : 94 °C for 30 s, 35 cycles of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 1 min, with a final step of 72 °C for 10 min.…”