Molecular characterization of Helja, an extracellular jacalin-related protein from Helianthus annuus: Insights into the relationship of this protein with unconventionally secreted lectins

Pinedo, Marcela; Orts, Facundo; Carvalho, André de Oliveira; Regente, Mariana; Soares, Júlia Ribeiro; Gomes, Valdirene Moreira; Canal, Laura de la

doi:10.1016/j.jplph.2015.06.004

Cited by 14 publications

(12 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Localization in the apoplast has been described for the homologous horcolin [ 21 ] as well as for the JRL helja from Helianthus annuus seeds [ 22 ]. In order to study the subcellular distribution of HvHorcH, we prepared an apoplast fraction of salt-stressed roots of cv.…”

Section: Resultsmentioning

confidence: 99%

The Jacalin-Related Lectin HvHorcH Is Involved in the Physiological Response of Barley Roots to Salt Stress

Witzel

Matros

Bertsch

et al. 2021

IJMS

View full text Add to dashboard Cite

Salt stress tolerance of crop plants is a trait with increasing value for future food production. In an attempt to identify proteins that participate in the salt stress response of barley, we have used a cDNA library from salt-stressed seedling roots of the relatively salt-stress-tolerant cv. Morex for the transfection of a salt-stress-sensitive yeast strain (Saccharomyces cerevisiae YSH818 Δhog1 mutant). From the retrieved cDNA sequences conferring salt tolerance to the yeast mutant, eleven contained the coding sequence of a jacalin-related lectin (JRL) that shows homology to the previously identified JRL horcolin from barley coleoptiles that we therefore named the gene HvHorcH. The detection of HvHorcH protein in root extracellular fluid suggests a secretion under stress conditions. Furthermore, HvHorcH exhibited specificity towards mannose. Protein abundance of HvHorcH in roots of salt-sensitive or salt-tolerant barley cultivars were not trait-specific to salinity treatment, but protein levels increased in response to the treatment, particularly in the root tip. Expression of HvHorcH in Arabidopsis thaliana root tips increased salt tolerance. Hence, we conclude that this protein is involved in the adaptation of plants to salinity.

show abstract

Section: Resultsmentioning

confidence: 99%

The Jacalin-Related Lectin HvHorcH Is Involved in the Physiological Response of Barley Roots to Salt Stress

Witzel

Matros

Bertsch

et al. 2021

IJMS

View full text Add to dashboard Cite

show abstract

“…To overcome this limitation, we decided to express Helja as a fusion protein with thioredoxin since it increases the solubility of heterologous proteins synthesized in E. coli cytoplasm [ 23 ]. Helja amino acid sequence was previously deduced by cloning and sequencing the complete coding sequence (CDS) [ 24 ]. Therefore, in this work, Helja CDS was cloned in the expression enterokinase/Ligation-independent cloning vector pET-32Ek/LIC to obtain a chimeric thioredoxin-Helja protein (Trx-rHelja) in the E. coli Rosetta-gami2 (DE3) pLysS expression strain.…”

Section: Resultsmentioning

confidence: 99%

“…The set of specific primers for amplification of the Helja coding sequence intended to directionally clone the sequence in the pET-32 EK/LIC vector was designed according to the vector instruction manual (pET System Manual, Novagen). The complete coding sequence of Helja was previously obtained, GenBank KJ681498 [ 24 ]. The forward primer was 5′- GACGACGACAAG ATGGCTAACAACTACGTTGAGG -3′ and the reverse was 5′- GAGGAGAAGCCCGGT CTAGGGACTAAGTACGA -3′.…”

Section: Methodsmentioning

confidence: 99%

Anti-Neuroblastoma Properties of a Recombinant Sunflower Lectin

Pinedo

Genoula

Silveyra

et al. 2017

IJMS

Self Cite

View full text Add to dashboard Cite

According to their sugar recognition specificity, plant lectins are proposed as bioactive proteins with potential in cancer treatment and diagnosis. Helja is a mannose-specific jacalin-like lectin from sunflower which was shown to inhibit the growth of certain fungi. Here, we report its recombinant expression in a prokaryotic system and its activity in neurobalstoma cells. Helja coding sequence was fused to the pET-32 EK/LIC, the enterokinase/Ligation-independent cloning vector and a 35 kDa protein was obtained in Escherichia coli representing Helja coupled to thioredoxin (Trx). The identity of this protein was verified using anti-Helja antibodies. This chimera, named Trx-rHelja, was enriched in the soluble bacterial extracts and was purified using Ni+2-Sepharose and d-mannose-agarose chromatography. Trx-rHelja and the enterokinase-released recombinant Helja (rHelja) both displayed toxicity on human SH-SY5Y neuroblastomas. rHelja decreased the viability of these tumor cells by 75% according to the tetrazolium reduction assay, and microscopic analyses revealed that the cell morphology was disturbed. Thus, the stellate cells of the monolayer became spheroids and were isolated. Our results indicate that rHelja is a promising tool for the development of diagnostic or therapeutic methods for neuroblastoma cells, the most common solid tumors in childhood.

show abstract

“…Lectins of various architectural types, such as LecP, LecRLPs, and LecRLKs, are readily found by proteomic approaches both in the cell wall and plasma membrane (Jamet et al, 2008;Bellande et al, 2017). The secretion of some lectins without signal peptides into the cell wall via non-classical way was demonstrated for animal galectins (Delacour et al, 2009) and plant proteins with EUL (Jamet et al, 2008;Dubiel et al, 2020) and jacalin-like (Pinedo et al, 2012(Pinedo et al, , 2015 domains.…”

Section: Numerous Lectins Have the Potential To Interact With Cell Wall Glycansmentioning

confidence: 99%

“…The fourth gene, distinguished by the presence of F-box (Figure 8B), was expressed in all analyzed tissues (Table 2). The encoded proteins do not have signal peptides and are considered nucleocytoplasmic mannosebinding proteins (Van Holle and Van Damme, 2019); however, research supports cell wall localization and secretion of such proteins via a non-classical pathway (Grunwald et al, 2007;Pinedo et al, 2012Pinedo et al, , 2015. Flax jacalin encoded by Lus10024290 was predicted to be secreted into the cell wall (Table 5).…”

Section: Differentially Expressed Flax Lectins Between Samples With Distinct Cell Wall Typesmentioning

confidence: 99%

Gene Expression Patterns for Proteins With Lectin Domains in Flax Stem Tissues Are Related to Deposition of Distinct Cell Wall Types

et al. 2021

View full text Add to dashboard Cite

The genomes of higher plants encode a variety of proteins with lectin domains that are able to specifically recognize certain carbohydrates. Plants are enriched in a variety of potentially complementary glycans, many of which are located in the cell wall. We performed a genome-wide search for flax proteins with lectin domains and compared the expression of the encoding genes in different stem tissues that have distinct cell wall types with different sets of major polysaccharides. Over 400 genes encoding proteins with lectin domains that belong to different families were revealed in the flax genome; three quarters of these genes were expressed in stem tissues. Hierarchical clustering of the data for all expressed lectins grouped the analyzed samples according to their characteristic cell wall type. Most lectins differentially expressed in tissues with primary, secondary, and tertiary cell walls were predicted to localize at the plasma membrane or cell wall. These lectins were from different families and had various architectural types. Three out of four flax genes for proteins with jacalin-like domains were highly upregulated in bast fibers at the stage of tertiary cell wall deposition. The dynamic changes in transcript level of many genes for lectins from various families were detected in stem tissue over the course of gravitropic response induced by plant gravistimulation. The data obtained in this study indicate a large number of lectin-mediated events in plants and provide insight into the proteins that take part in tissue specialization and reaction to abiotic stress.

show abstract

Molecular characterization of Helja, an extracellular jacalin-related protein from Helianthus annuus: Insights into the relationship of this protein with unconventionally secreted lectins

Cited by 14 publications

References 49 publications

The Jacalin-Related Lectin HvHorcH Is Involved in the Physiological Response of Barley Roots to Salt Stress

The Jacalin-Related Lectin HvHorcH Is Involved in the Physiological Response of Barley Roots to Salt Stress

Anti-Neuroblastoma Properties of a Recombinant Sunflower Lectin

Gene Expression Patterns for Proteins With Lectin Domains in Flax Stem Tissues Are Related to Deposition of Distinct Cell Wall Types

Contact Info

Product

Resources

About