Molecular characterization of leukocyte adhesion deficiency in six patients

Wright, Ann H.; Douglass, Wendy; Taylor, G. M.; Lau, Yu‐Lung; Higgins, David; Davies, KA; Law, S.K. Alex

doi:10.1002/eji.1830250313

Cited by 39 publications

(48 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…␤-Strand and ␣-helix segments are highlighted in pink and yellow, respectively, as predicted for the human ␤2 I-like domain with PHD (49) using a multiple alignment of 35 ␤ subunit sequences or determined for structures of I and A domains with DSSP (76). Above the human ␤2 sequence are shown residues that differ in mouse (black) or that are mutated in LAD (green) (14,68). Dots above the human ␤2 sequence show every 10th residue.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Structural and Functional Studies with Antibodies to the Integrin β2 Subunit

Huang¹,

Zang²,

Takagi³

et al. 2000

Journal of Biological Chemistry

View full text Add to dashboard Cite

To establish a structure and function map of the ␤2 integrin subunit, we mapped the epitopes of a panel of ␤2 monoclonal antibodies including function-blocking, nonblocking, and activating antibodies using human/mouse ␤2 subunit chimeras. Activating antibodies recognize the C-terminal half of the cysteine-rich region, residues 522-612. Antibodies that do not affect ligand binding map to residues 1-98 and residues 344 -521. Monoclonal antibodies to epitopes within a predicted I-like domain (residues 104 -341) strongly inhibit LFA-1-dependent adhesion. These function-blocking monoclonal antibodies were mapped to specific residues with human 3 mouse knockout or mouse 3 human knock-in mutations. Combinatorial epitopes involving residues distant in the sequence provide support for a specific alignment between the ␤-subunit and I domains that was used to construct a three-dimensional model. Antigenic residues 133, 332, and 339 are on the first and last predicted ␣-helices of the I-like domain, which are adjacent on its "front." Other antigenic residues in ␤2 and in other integrin ␤ subunits are present on the front. No antigenic residues are present on the "back" of the domain, which is predicted to be in an interface with other domains, such as the ␣ subunit ␤-propeller domain. Most mutations in the ␤2 subunit in leukocyte adhesion deficiency are predicted to be buried in the ␤2 subunit I-like domain. Two long insertions are present relative to ␣-subunit I-domains. One is tied down to the back of the I-like domain by a disulfide bond. The other corresponds to the "specificity-determining loop" defined in ␤1 and ␤3 integrins and contains the antigenic residue Glu 175 in a disulfide-bonded loop located near the "top" of the domain.

show abstract

Section: Discussionmentioning

confidence: 99%

“…The residues that are mutated in LAD patients (14,68) are shown as pink lollipops or spheres in Fig. 5A and above the ␤2 sequence in green in Fig.…”

mentioning

confidence: 99%

Structural and Functional Studies with Antibodies to the Integrin β2 Subunit

Huang¹,

Zang²,

Takagi³

et al. 2000

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…cDNA Expression Constructs-The ␣ L and ␤ 2 cDNAs in the expression vector pcDNA3 (Invitrogen) were described previously (26,27). Previously, we had numbered the N-terminal Met of ␤ 2 as "1" (4) and relevant references therein.…”

Section: Methodsmentioning

confidence: 99%

Epitope Mapping of Monoclonal Antibody to Integrin αL β2 Hybrid Domain Suggests Different Requirements of Affinity States for Intercellular Adhesion Molecules (ICAM)-1 and ICAM-3 Binding

Tang

Tng

Law

et al. 2005

Journal of Biological Chemistry

Self Cite

107

View full text Add to dashboard Cite

Integrin undergoes different activation states by changing its quaternary conformation. The integrin ␤ hybrid domain acts as a lever for the transmission of activation signal. Integrins represent a large family of type I heterodimeric (␣ and ␤ subunits) membrane proteins capable of bidirectional signal transduction serving cell growth, differentiation, and apoptosis (1). The ␤ I-like domain is flanked by the hybrid and PSI 1 (for plexins, semaphorins, and integrins) domains (Fig. 1A) (2, 3). The hybrid domain has been shown to be important in the propagation of the activation signal from one end of the ␤ subunit to the other (2, 4-6). Recently, superimposed structural coordinates of liganded-open ␣ IIb ␤ 3 headpiece with that of unliganded-closed ␣ V ␤ 3 revealed an ϳ10-Å shift and a concomitant rotation of the hybrid domain relative to the last helix of the ␤ I-like domain upon ligand binding (7). mAbs that attenuate this swing-out motion of the integrin ␣ 5 ␤ 1 hybrid domain prevent effective allosteric activation of the ␤ I-like domain (5, 6).Collective observations from electron microscopy images and crystal structures of integrin ␣ IIb ␤ 3 , ␣ V ␤ 3 , and ␣ 5 ␤ 1 suggest that integrin may undergo at least three activation states depicted by different quaternary conformations (3, 7-13). A bent integrin with the hybrid domain in close proximity of the integrin epidermal growth factor (I-EGF) 3 and 4 domains represents the resting state. The extended integrin with the hybrid domain distally separated from I-EGF 3 and 4 but orientated toward the ␣ subunit ␤-propeller depicts a low affinity state, whereas the extended integrin with a swing-out hybrid domain away from the ␣ subunit ␤-propeller represents a high affinity state.The conceptualization of different integrin affinity states also derives from earlier functional studies. Observations were made on integrins having different ligand binding properties under different cellular or extracellular conditions. Resting platelet integrin ␣ IIb ␤ 3 binds immobilized fibrinogen, but binding to soluble fibrinogen, fibronectin, or von Willebrand factor requires platelet activation by agonist (14 -16). Divalent cation Mn 2ϩ activates integrin ␣ 4 ␤ 1 to bind VCAM-1, whereas adhesion to fibronectin-derived CS-1 peptide requires additional activating mAb (17). Real time analysis of integrin ␣ 4 ␤ 1 binding to fluorescent-conjugated ligand mimetic via chemokine receptor activation on leukocytes also suggests integrin acquiring multiple affinity states (18). For the integrin ␣ L ␤ 2 , ligand ICAM-1 exhibits higher affinity for purified ␣ L ␤ 2 from T cells than . Prior exposure of ␣ L ␤ 2 to ICAM-1 increased its binding to . Soluble ICAM (sICAM)-3 binds to ␣ L ␤ 2 with 9-fold lower affinity than sICAM-1 (21). We also reported the requirement of two ␣ L ␤ 2 -activating mAbs, KIM185 and KIM127, for their adhesion to ICAM-3 as compared with ICAM-1 (22). Crystal structures of engineered intermediate affinity ␣ L I-domain (L161C/F299C) and high affinity ␣ L I-domain (K287C/K294C...

show abstract

“…The sequences of the oligonucleotides are A87/19, CCAGGGCAGACTGGTAGCAAAGCC; I67, GAAACTGAGGCAGGTAACC; I78, GCTCTGTCAGGTGGA-GACC; E94/03, TCAGTGGTGTCCTGCCAG; and E94/04, TGCTGGTGTTTGCCACTG. All other oligonucleotides were described previously (25).…”

Section: Methodsmentioning

confidence: 99%

A novel leukocyte adhesion deficiency caused by expressed but nonfunctional β2 integrins Mac-1 and LFA-1

Hogg¹,

Stewart²,

Scarth³

et al. 1999

J. Clin. Invest.

164

134

View full text Add to dashboard Cite

The adhesive response of circulating leukocytes to inflammatory stimuli is now well documented (1, 2). After such signals, leukocytes adhere to the blood vasculature using selectin-mediated interactions, and this stage leads to activation of their integrins. The β2 or leukocyte integrins lymphocyte function-associated molecule (LFA)-1 (CD11a/CD18) has a major role in the firm adhesion of leukocytes to endothelium and in their migration across this barrier. In addition, LFA-1 cooperates with the T-cell receptor in antigen-stimulated T-cell priming (3) and, in general, participates in the formation of leukocyte-leukocyte contacts. Mac-1 (CD11b/CD18) is a major phagocytic receptor operating in association with the third β2 integrin, p150,95 (CD11c/CD18), and both recognize as ligands fibrinogen and the complement fragment iC3b (4, 5).Expression of integrins on the cell membrane is not a guarantee of their ability to function as adhesion receptors. Integrins must undergo conversion from inactive to active ligand-binding status, which occurs through a process of clustering and/or altered conformation (6, 7). The stimulus for this activation is initiated by the triggering of other membrane receptors, a route of signal transduction that has been termed "inside out" signaling. The integrins bind divalent cations such as Mg 2+ or Mn 2+ in order to function, and an alternative means of directly altering integrin activity is through extracellular exposure to these cations. It is thought that these latter procedures mimic the conformational changes brought about by integrin-activating signals generated intracellularly. Special anti-integrin monoclonal antibodies (MABs) can serve as reporters of this activation. For example, MAB 24 recognizes an epitope on high-affinity β2 integrin (7) and detects a conformational change in the form of interdomain movement involving the ligand binding I domain on the integrin α subunit (8).Valuable information about the functioning of the β2 integrins has come from study of the leukocyte adhesion deficiency (LAD)-1 syndrome. LAD-1 is an autosomal recessive disorder caused by mutation in the CD18 gene on chromosome 21 that leads to absent or aberrant biosynthesis of the β2 subunit of leukocyte integrins (9-11). This lesion is reflected in the absence or markedly diminished expression on the leukocyte cell surface of the β2 integrins, CD11a/CD18 (LFA-1), CD11b/CD18 (Mac-1), and CD11c/CD18 (p150,95). The patient phenotype is variable but reflects the level of β2 integrins expressed. Patients with <1% expression suffer from life-threatening infections and require bone marrow transplantation for long-term survival (12). In patients with 1%-10% expression, defects in leukocyte mobility, adherence, and endocytosis lead to periodic periodontitis, skin infections, and retarded wound healing with dysplastic scarring. The heterozygotic relatives of the patients have ∼40%-60% normal levels of β2 inte- In the leukocyte adhesion deficiency (LAD)-1 syndrome, there is diminished expression of β2 (CD18) inte...

show abstract

Molecular characterization of leukocyte adhesion deficiency in six patients

Cited by 39 publications

References 31 publications

Structural and Functional Studies with Antibodies to the Integrin β2 Subunit

Structural and Functional Studies with Antibodies to the Integrin β2 Subunit

Epitope Mapping of Monoclonal Antibody to Integrin αL β2 Hybrid Domain Suggests Different Requirements of Affinity States for Intercellular Adhesion Molecules (ICAM)-1 and ICAM-3 Binding

A novel leukocyte adhesion deficiency caused by expressed but nonfunctional β2 integrins Mac-1 and LFA-1

Contact Info

Product

Resources

About