Molecular cloning and characterization of Schistosoma mansoni Ftz-F1 interacting protein-1 (SmFIP-1), a novel corepressor of the nuclear receptor SmFtz-F1

Oger, Frédérik; Bertin, Benjamin; Caby, Stéphanie; Dalia-Cornette, Jocelyne; Adams, Martin; Vicogne, Jérôme; Capron, Moníque; Pierce, Raymond J.

doi:10.1016/j.molbiopara.2006.02.016

Cited by 7 publications

(5 citation statements)

References 45 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Primers specific for Sm2DBDα (forward: 5'-CCGCTGCATCAATCACCTATT-3', reverse: 5'-TGCGCAAAATGTAGCCGAT-3'), Sm2DBDβ (forward: 5'-TGCACTGACTCCCACCACA-3', reverse: 5'-AGCAGTGGATGACGTCGGA-3') and Sm2DBDγ (forward: 5'-GAACATCGTGAATCAATTTTACATTCAG-3', reverse: 5'- ATGTACTGTTTCATTGCATTCATTTG-3') were designed using Primer Express Program (Applied Biosystems™). Primers specific for S. mansoni α-tubulin [GenBank: M80214] were according to [63]. Reverse-transcribed cDNA samples were used as templates for PCR amplification using SYBR Green Master Mix ® (Invitrogen) and BIORAD IQ™5 Real-Time PCR Detection System.…”

Section: Methodsmentioning

confidence: 99%

Evolution of a novel subfamily of nuclear receptors with members that each contain two DNA binding domains

Niles

Hirai

et al. 2007

BMC Evol Biol

View full text Add to dashboard Cite

show abstract

Section: Methodsmentioning

confidence: 99%

Evolution of a novel subfamily of nuclear receptors with members that each contain two DNA binding domains

Niles

Hirai

et al. 2007

BMC Evol Biol

View full text Add to dashboard Cite

show abstract

“…Reverse‐transcribed cDNA samples were used as templates for PCR amplification using SYBR Green Master Mix ® (Invitrogen) and BIO‐RAD IQ™5 Real‐Time PCR Detection System (Bio‐Rad Laboratories, Hercules, CA 94547, USA). Primers specific for SmNR1 (forward: 5′‐AAAAACATCCCCCATTTCAGAA‐3′, reverse: 5′‐AACTACGCACATTCGGGTTGA‐3′) were designed by Primer Express Program (Applied Biosystems ™ ) and primers specific for S. mansoni α‐tubulin (GenBank ) were designed according to [54]. The efficiency for each primer set is evaluated and recorded during assay development by iQ5 application (cDNA is diluted to ×1‐, ×10‐, ×100‐ and ×1000‐fold; see protocol of Bio‐Rad iQ5 application).…”

Section: Methodsmentioning

confidence: 99%

Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1)

Niles

Hirai

et al. 2006

The FEBS Journal

View full text Add to dashboard Cite

A cDNA encoding a nuclear receptor subfamily I member in the platyhelminth Schistosoma mansoni (SmNR1) was identified and characterized. SmNR1 cDNA is 2406 bp long and contains an open reading frame encoding a 715 residue protein. Phylogenetic analysis demonstrates that SmNR1 is a divergent member of nuclear receptor subfamily I with no known orthologue. SmNR1 was localized to S. mansoni chromosome 1 by fluorescent in situ hybridization. Gene structure of SmNR1 was determined showing it to consist of eight exons spanning more than 14 kb. Quantitative real‐time RT‐PCR showed that SmNR1 was expressed throughout schistosome development with a higher expression in eggs, sporocysts and 21‐day worms. SmNR1 contains an autonomous transactivation function (AF1) in the A/B domain as demonstrated in a yeast one‐hybrid assay; it interacts with SmRXR1 in a yeast two‐hybrid assay and in a glutathione S‐transferase pull‐down assay. Electrophoretic mobility shift assay showed that SmNR1 could form a heterodimer with SmRXR1 to bind to DNA elements containing the half‐site AGGTCA, a direct repeat of the half‐site separated by 0–5 nucleotides (DR1‐DR5) and a palindrome repeat of the half‐site not separated by nucleic acids (Pal0). Transient transfection in mammalian COS‐7 cells showed that SmNR1/SmRXR1 could enhance the transcriptional activation of a DR2‐dependent reporter gene. Our results demonstrate that SmNR1 is a partner of SmRXR1.

show abstract

“…SAGE tags for these Hox genes as well as the related nuclear receptor co-repressor S. mansoni Fushi Tarazu-Factor 1 interacting protein (Oger et al, 2006) were identified and their expression pattern analyzed. While the expression of Fushi Tarazu-Factor 1 interacting protein was seen in all developmental stages analyzed, as was suggested previously (Oger et al, 2006), it was found to vary from a low of 0.0044% in AF_SS (3 tags in 68,123 total tags) to 0.01519% in 20D_S_COND (8 tags out of 52,666 total tags), a difference of 3.5 fold (Fig. 2).…”

Section: Expression Analysismentioning

confidence: 99%

Profiling Schistosoma mansoni development using serial analysis of gene expression (SAGE)

Williams

Sayed

Bernier

et al. 2007

Experimental Parasitology

View full text Add to dashboard Cite

Despite the widespread use of chemotherapy and other control strategies over the past 50 years, transmission rates for schistosomiasis have changed little. Regardless of the approach used, future control efforts will require a more complete understanding of fundamental parasite biology. Schistosomes undergo complex development involving an alteration of parasite generations within a mammalian and freshwater molluscan host in the completion of its lifecycle. Little is known about factors controlling schistosome development, but understanding these processes may facilitate the discovery of new control methods. Therefore, our goal in this study is to determine global developmentally-regulated and stage-specific gene expression in Schistosoma mansoni using Serial Analysis of Gene Expression (SAGE). We present a preliminary analysis of genes expressed during development and sexual differentiation in the mammalian host and during early larval development in the snail host. A number of novel, differentially expressed genes have been identified, both within and between the different developmental stages found in the mammalian and snail hosts.

show abstract

Molecular cloning and characterization of Schistosoma mansoni Ftz-F1 interacting protein-1 (SmFIP-1), a novel corepressor of the nuclear receptor SmFtz-F1

Cited by 7 publications

References 45 publications

Evolution of a novel subfamily of nuclear receptors with members that each contain two DNA binding domains

Evolution of a novel subfamily of nuclear receptors with members that each contain two DNA binding domains

Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1)

Profiling Schistosoma mansoni development using serial analysis of gene expression (SAGE)

Contact Info

Product

Resources

About