Molecular Cloning of α_1d‐Adrenergic Receptor and Tissue Distribution of Three α₁‐Adrenergic Receptor Subtypes in Mouse

Abstract

A partial cDNA encoding most of the third intracellular loop of the mouse a, d -adrenergic receptor subtype was amplified from hippocampus by reverse transcription-polymerase chain reaction (RT-PCR) using degenerate oligodeoxynucleotide primers . This DNA fragment was used as a probe to isolate an a, d -adrenergic receptor cDNA from a mouse brain cDNA library . The deduced amino acid sequence encodes a potential protein of 562 amino acids, and northern hybridization of poly(A)+ RNA isolated from mouse brain detected a single 3 .0-kb transcript . Partial cDNA fragments of the alband a, a -adrenergic receptor subtypes were also amplified from mouse brain and sequenced . Analysis of the mRNA expression by RT-PCR indicated that the a,-adrenergic receptors are widely distributed in mouse tissues . The a,d subtype is expressed in brain areas such as hippocampus, striatum, and brainstem and also in many extracerebral tissues, such as lung, liver, heart, kidney, and spleen . The a,a subtype is also expressed in many tissues, whereas the alb subtype has a more restricted expression, with high levels in striatum, brainstem, and diencephalus . Key Words : a,d -Adrenergic receptor-Mouse-cDNA cloning-Tissue distribution -a,-Adrenergic receptor subtypes . J. Neurochem . 65, 2387Neurochem . 65, -2392Neurochem . 65, (1995 .The adrenergic receptors are members of a large family of membrane proteins that are coupled to guanine nucleotide-binding proteins (G proteins) . They are currently divided into three types (a,, a2 , and ß), each having several receptor members (Lomasney et al., 1991a ;Bylund, 1992) . Radioligand binding data with the a,-adrenergic receptor agonists oxymetazoline and methoxamine and the antagonists WB4101 and phentolamine indicated the existence of two a,-adrenergic receptor subtypes in rat cerebral cortex, which were named a1A and a,B (Battaglia et al., 1983 ; Morrow and Creese, 1986;Han et al., 1987) .Several cDNAs and genes encoding a t-adrenergic receptor subtypes from various sources, and initially named a]A/alD, a,B , and a lc , have been isolated by

Heterodimerization with β2-Adrenergic Receptors Promotes Surface Expression and Functional Activity of α1D-Adrenergic Receptors

“…However, other recent studies utilizing double ␣ 1A -/␣ 1B -AR knockout mice have revealed the presence of functional ␣ 1D -AR, even in the absence of other ␣ 1 -AR subtypes (Turnbull et al, 2003). Additionally, ␣ 1D -AR is found in some tissues that lack ␣ 1B -AR expression such as human bladder and specific regions of the spinal cord and brain, as well as certain rat and human blood vessels (Alonso-Llamazares et al, 1995;Michelotti et al, 2000;Tanoue et al, 2002;Sadalge et al, 2003). Thus, it is reasonable to speculate that trafficking of functional ␣ 1D -AR to the cell surface may involve the interaction of ␣ 1D -AR with other proteins beyond ␣ 1B -AR.…”

The α1D-adrenergic receptor directly regulates arterial blood pressure via vasoconstriction

“…The primers for the α 1D -AR gene were located within the first exon, and the forward primer was within the region replaced with the Neo in the mutant allele. The primers were derived from the murine α 1A (25), α 1B (25), and α 1D (19,25) sequences. The GAPDH primers (5′→3′) were GGTCATCATCTCCGCCCCTTC upstream and CCACCAC-CCTGTTGCTGTAG downstream (662 bp).…”

The α1D-adrenergic receptor directly regulates arterial blood pressure via vasoconstriction

“…The specificity of the amplified DNA fragments was determined by Southern blot analysis using receptor-specific 32 P-labeled probes (cDNAs of the murine α 1A -AR, α 1B -AR, and α 1D -AR; ref. 25).…”