Molecular diagnosis and haemato-biochemical changes in Anaplasma marginale infected dairy cattle

Abstract

The present study was a undertaken to diagnose Anaplasma marginale in naturally infected crossbred cows and to determine its effect on haemato-biochemical profile. Blood samples were collected from animals (200) for detection of the rickettsial organism by direct smear and direct blood PCR based techniques targeting the major surface protein 5 (MSP-5). Direct blood PCR revealed a 382-bp amplified fragment in positive control samples. When random blood samples were screened under light microscope and direct blood PCR method, 7.5% of samples were positive under microscopic examination whereas PCR analysis revealed 10.5% samples positive for A. marginale. The infected group (25) showed significantly decreased levels of TEC, Hb and PCV than healthy control animals. However, differences in the red blood cell indices were non-significant indicating normocytic normochromic anaemia in affected crossbred cattle. Serum samples (25) of infected cows showed significantly higher values of ALT, AST, BUN, creatinine and TBIL than that of healthy control. A significant decrease of TSP and albumin was also recorded in the infected cows compared to healthy control. The standardized PCR method of the present investigation may be useful for rapid and accurate diagnosis of A. marginale in subclinical/carrier animals as the whole blood could be directly used. Haemato-biochemical studies concluded that anaemia and erythrophagocytosis are considered to be the major components of this disease and adversely affect liver and soft tissue of the affected animals.

Seasonal Investigation of Anaplasma marginale Infection in Pakistani Cattle Reveals Hematological and Biochemical Changes, Multiple Associated Risk Factors and msp5 Gene Conservation

“…Genomic DNA extraction was performed on the blood samples using an inorganic method according to Saeed et al [24], and the DNA was stored at −20 • C until use. A set of oligonucleotide primers, Fwd 5 ACAGGCGAAGAAGCAGACAT3 and Rev 5 ATAAATGGGAACACGGTGGA 3 , was used to specifically amplify 382 base pairs of the msp5 gene of A. marginale in positive blood samples [25]. The reaction mixture was prepared in a final volume of 25 µL, containing 13 mM Tris-HCl (pH 8.3), 65 mM KCl, 2 mM MgCl2, 0.0013% gelatin, 300 µM of each dNTP, 1 U of AmpliTaq DNA polymerase, 0.5 µM of each primer and 5 µL (50 to 150 ng) of template DNA.…”

“…The reaction mixture was prepared in a final volume of 25 µL, containing 13 mM Tris-HCl (pH 8.3), 65 mM KCl, 2 mM MgCl2, 0.0013% gelatin, 300 µM of each dNTP, 1 U of AmpliTaq DNA polymerase, 0.5 µM of each primer and 5 µL (50 to 150 ng) of template DNA. Reaction conditions included an initial denaturation step of 94 • C for 5 min, followed by 30 cycles of denaturation at 94 • C for 45 s, primer annealing at 53 • C for 50 s and extension at 72 • C for 50 s. A final extension at 72 • C for 7 min was performed [25]. Anaplasma marginale-positive and -negative samples were also added during each PCR reaction as positive and negative controls, respectively.…”

Hematobiochemical, serological, and molecular detection of Anaplasma marginale in dromedary camels (Camelus dromedarius) in Al-Najaf desert, Iraq

“…Major surface proteins are highly conserved in Anaplasmataceae. Anaplasma marginale MSP5 can be used to identify and construct phylogenetic trees [16], as well as to identify carriers [11].…”

“…Anaplasma marginale MSP5 gene was amplified using extracted DNA and the indicated primer sets AMF: 5′-ACAGGCGAAGAAGCAGACAT-3′ and AMR: 5′-ATAAATGGGAACACGGTGGA-3′ [8,16].…”

A study of biochemical changes in river buffaloes (Bubalus bubalis) naturally infected with Anaplasma marginale

“…Several studies in cattle have shown that natural or experimental infection with A. marginale is associated with significant changes in serum biochemical parameters comprising elevation in creatinine and bilirubin concentrations, some liver enzyme activities and some acute phase proteins and decline in serum total protein and albumin concentration (Allen et al, 1981;Coskun et al, 2012;Sharma et al, 2013;Jassem and agar, 2015;Ganguly et al, 2018).…”