Molecular diversity ofCladophialophora carrioniiin patients with chromoblastomycosis in Venezuela

Abstract

We identified 29 Cladophialophora carrionii isolates recovered from Venezuelan patients with chromoblastomycosis using phenotypic and molecular characteristics. The genetic diversity of isolates was assessed by enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC-PCR) fingerprinting. We detected four electrophoretic patterns divided into two main clusters (I and II) comprising 10 and 17 isolates, respectively, and two minor clusters (III and IV) with one isolate each. An interesting cluster-age-lesion type association was detected. The median age of patients in cluster I was 37.5 years and in cluster II, 55 years of age (P = 0.04). The C. carrionii isolates found in cluster I were generally obtained from crusty lesions (60%) and isolates in cluster II were usually recovered from plaque type lesions (53%) even though the P values were only slightly less than significant (P = 0.08). No associations were found among the genetic features strains in the two clusters and gender, occupation, geographic origin, lesion size, severity, and duration of the disease. There was also no correlation between antifungal susceptibilities and strain clustering. In conclusion, molecular typing using ERIC-PCR revealed a genomic heterogeneity in the C. carrionii clinical isolates studied.

In Vitro Antifungal Susceptibility of Cladophialophora carrionii, an Agent of Human Chromoblastomycosis

“…The MIC 90 s of fluconazole, amphotericin B, micafungin, and caspofungin were 64 g/ml, 8 g/ml, 4 g/ml, and 2 g/ml, respectively. These data are in agreement with previously reported findings for Cladophialophora (11,15), Rhinocladiella (16), and Fonsecaea (17). No difference was found in the activities between voriconazole and isavuconazole against C. carrionii (MIC range, 0.016 to 1 g/ml; GM, 0.148/0.136 g/ml; MIC 90 , 0.25 g/ml).…”

“…The activities against Chinese and Australian strains were intermediate. For amphotericin B, the MIC range (0.5 to 8 g/ml) and MIC 90 (8 g/ml) were much higher than those of C. bantiana (MIC range, 0.125 to 2 g/ml; MIC 90 , 1 g/ml) (15) and Fonsecaea (MIC range, 0.5 to 2 g/ml; MIC 90 , 2 g/ml) (17) and confirmed the results from a recent study (11). The 81 investigated isolates of C. carrionii represented a worldwide collection from four continents: South America (n ϭ 46), Asia (n ϭ 20), Africa (n ϭ 9), and Australia (n ϭ 6).…”

“…Several therapies have been applied, but there is no standard for treatment (3). Small series of in vitro susceptibility studies with itraconazole, voriconazole, and terbinafine have been published showing considerable variation between and within genera and species (11,12).The aim of the present study was to determine the susceptibility profiles of a large collection of C. carrionii strains to nine antifungal agents, including isavuconazole (13). Isolates were taken from the reference collections of the CBS-KNAW Fungal Biodiversity Centre (CBS, Utrecht, The Netherlands) or the Institute Pasteur (CNRMA/IP, Paris, France).…”

“…Several therapies have been applied, but there is no standard for treatment (3). Small series of in vitro susceptibility studies with itraconazole, voriconazole, and terbinafine have been published showing considerable variation between and within genera and species (11,12).…”

Molecular identification of unusual Mycetoma agents isolated from patients in Venezuela

“…For the identification of actinomycetes, the 16S rDNA region was analysed. DNA from mycetoma cultures (fungi and actinomycetes) was extracted according to our earlier study . The extracted DNA samples were amplified by PCR with the primer sets ITS‐4 (5′‐TCCTCCGCTTATTGATATGC‐3′) and ITS‐5 (5′‐GGAAGTAAAAGTCGTAACAAGG‐3′) for ITS region, NL‐1(5′‐GCATATCAATAAGCGGAGGAAAAG‐3′) and NL‐4m (5′‐GGTCCGTGTTTCAAGACG‐3′) for D1/D2 domain of the 28S rDNA and Noc1 (5′‐GCTTAACACATGCAAGTCG‐3′) and Noc2 (5′‐GAATTCCAGTCTCCCCTG‐3′) for the case of actinomycetes .…”