Molecular Evidence for Parallel Evolution of Adaptive Syndromes in Fig-BreedingLissocephala(Drosophilidae)

Harry, Myriam; Solignac, Michel; Lachaise, Daniel

doi:10.1006/mpev.1998.0508

Cited by 92 publications

(71 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…This result is, however, in agreement with the proposition of raising the ananassae and montium species subgroups to species groups (Da Lage et al 2007). A barcode in the genus Lissocephala was sequenced for the first time and branched within the subgenus Sophophora, an unexpected observation needing confirmation, since this genus is generally given a basal position in Drosophilinae based on morphology (Throckmorton 1975) or molecular data (Harry et al 1996(Harry et al , 1998Yassin 2013). A species which we identified as belonging to the genus Microdrosophila, based on Burla's (1954b) key to drosophilids from Ivory Coast, branches in the genus Zaprionus, an unexpected result since the morphology of this morphospecies differs from that of Zaprionus, which is very homogeneous across species.…”

Section: Discussionsupporting

confidence: 82%

Connecting systematic and ecological studies using DNA barcoding in a population survey of Drosophilidae (Diptera) from Mt Oku (Cameroon)

Prigent

Suwalski

Veuille

2017

EJT

View full text Add to dashboard Cite

D N A L i b r a r y o f L i f e , r e s e a r c h a r t i c l eurn:lsid:zoobank.org:pub:41D67A95-553F-4A8E-BC50-33BAA1FA5B0A Abstract. The characters used in taxonomy to describe new species cannot always be used to identify species in population surveys involving large samples. We used DNA barcoding to validate the taxonomic status of the morphospecies used in an ecological study involving 11 000 individual African drosophilids which had been determined without dissection. Some taxonomic information had been lost by not discriminating between rare species or by mistakenly splitting a morphologically variable species into two groups. However, the original ecological dataset provided a reliable picture of species diversity and the conclusions based on the original dataset are still supported by the molecular data.

show abstract

Section: Discussionsupporting

confidence: 82%

Connecting systematic and ecological studies using DNA barcoding in a population survey of Drosophilidae (Diptera) from Mt Oku (Cameroon)

Prigent

Suwalski

Veuille

2017

EJT

View full text Add to dashboard Cite

show abstract

“…CTAATGCAATAACTCCTCC (Harry et al, 1998). For cytochrome c oxidase subunit I (coxI), we used forward primer, LCO1490 GGTCAACAAATCATAAAGATATTGG, and reverse primer HCO2198 TAAACTTCAGGGTGACCAAAAAAT (Folmer et al, 1994).…”

Section: Dna Extraction and Sequencingmentioning

confidence: 99%

Phylogeny and DNA barcoding of inquiline oak gallwasps (Hymenoptera: Cynipidae) of the Western Palaearctic

Ács

Challis

Bihari

et al. 2010

Molecular Phylogenetics and Evolution

View full text Add to dashboard Cite

The NERC and CEH trade marks and logos ('the Trademarks') are registered trademarks of NERC in the UK and other countries, and may not be used without the prior written consent of the Trademark owner. We examine phylogenetic relationships within the Synergus complex of herbivorous 50 inquiline gallwasps associated with (Hymenoptera; Cynipidae; Synergini) associated with cynipid host galls on oak, a biologically diverse group whose genus-level morphological taxonomy has long been considered stable but whose species level taxonomy is problematic.We incorporate data for over 80% of recognised Western Palaearctic species in 5 morphology-based genera (Ceroptres, Saphonecrus, Synergus, Synophrus, Ufo), comprising 55 sequence for two mitochondrial two mitochondrial loci (coxI, cytb) and one nuclear locus (28S D2). In particular, we assess the evidence for monophyly of two long-established, morphology-defined sections within the genus Synergus that differ in a range of biological traits between-generation polymorphism and impact on the host gall inducer (lethal versus non-lethal). To aid analyses of ecological interactions within oak cynipid communities, we 60 also consider the utility of cytochrome oxidase I (coxI) DNA barcodes in the oak inquilines.In this assessment, we do not assume that species are delineated at a single threshold value of sequence divergence for a single gene, but examine concordance in the composition of molecular operational Taxonomic units (MOTUs) across a range of sequence divergences in each gene and across genes. We also assess the impact of sampling effort on MOTU stability. 65Phylogenetic reconstructions for all three loci support monophyly for Synergus and Synophrus, but reject monophyly for Saphonecrus and for the two sections within Synergus.The suites of traits associated with the two sections of the genus Synergus are thus homoplasious. All three loci also reject monophyly for three Synergus species (S. hayneanus, S. pallipes, S. umbraculus). Sequences for each locus identify robust MOTUs that are largely 70 concordant across loci for a range of cut-off values. Though many MOTU's correspond to recognised Linnean species, there is significant, multigene disagreement between groupings supported by morphology and sequence data, with both allocation of different morphospecies to the same MOTU and allocation of the same morphospecies to multiple MOTUs, regardless 3 of cutoff value. Our results imply that while DNA barcoding has considerable utility within 75 this group, morphology-based identification needs major revision at both genus and species levels. Further, lifehistory traits currently attributed to single morphospecies probably confound attributes of multiple lineages. Revealing patterns of character state evolution in Synergus requires collection of new host association and life history data explicitly linked to DNA barcode data for the specimens concerned. 80

show abstract

“…In (Kocher et al, 1989;Irwin et al, 1991;Janczewski et al, 1995;Ledje and Arnason, 1996;Yoder et al, 1996;Griffiths, 1997), but has not been fully developed in insect phylogenetic studies Crozier, 1993, 1994;Jermiin and Crozier, 1994;Crozier et al, 1995;Harry et al, 1998). Fig.…”

Section: Introductionmentioning

confidence: 95%

Molecular Phylogeny of theCeratosolenSpecies PollinatingFicusof the SubgenusSycomorus sensu stricto:Biogeographical History and Origins of the Species-Specificity Breakdown Cases

Kerdelhué

Clainche

Rasplus

1999

Molecular Phylogenetics and Evolution

View full text Add to dashboard Cite

Molecular Evidence for Parallel Evolution of Adaptive Syndromes in Fig-BreedingLissocephala(Drosophilidae)

Cited by 92 publications

References 29 publications

Connecting systematic and ecological studies using DNA barcoding in a population survey of Drosophilidae (Diptera) from Mt Oku (Cameroon)

Connecting systematic and ecological studies using DNA barcoding in a population survey of Drosophilidae (Diptera) from Mt Oku (Cameroon)

Phylogeny and DNA barcoding of inquiline oak gallwasps (Hymenoptera: Cynipidae) of the Western Palaearctic

Molecular Phylogeny of theCeratosolenSpecies PollinatingFicusof the SubgenusSycomorus sensu stricto:Biogeographical History and Origins of the Species-Specificity Breakdown Cases

Contact Info

Product

Resources

About