Molecular identification of diminazene aceturate resistant trypanosomes in tsetse flies from Yoko in the Centre region of Cameroon and its epidemiological implications

Simo, Gustave; Magang, Eugenie Melaine Kemta; Mewamba, Estelle Mezajou; Farikou, Oumarou; Kamga, Rolin M. N.; Tume, Christopher; Solano, Philippe; Ravel, Sophie

doi:10.1016/j.parepi.2020.e00135

Cited by 13 publications

(7 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Ten days after inoculation, the cultured mycelia were collected using vacuum filtration to remove the fermentation broth. Genomic DNA was extracted from the sanghuang mycelia using the cetyltrimethylammonium bromide (CTAB) method and used as a template for ITS amplification with the PCR primers, ITS1 (5′‐TCCGTAGGTGAACCTGCGG‐3′) and ITS4 (5′‐TCCTCCGCTTATTGATATGC‐3′), as described previously 22, 23 . The PCR system included a 25 μL solution containing 0.2 μL of EasyTaq polymerase (TransGen Biotech, Beijing, China), 2.5 μL of 10× EasyTaq Buffer, 2.0 μL of dNTPs (2.5 μmol L −1 ), 1.0 μL of each primer (10 μmol L −1 ), 2.0 μL of DNA template (20 ~ 50 ng μL −1 ), and 17.3 μL of ddH 2 O.…”

Section: Methodsmentioning

confidence: 99%

Purification and antioxidant and anti‐Inflammatory activity of extracellular polysaccharopeptide from sanghuang mushroom, Sanghuangporus lonicericola

et al. 2020

View full text Add to dashboard Cite

BACKGROUNDSanghuang mushrooms are medicinal fungi widely used in eastern Asia. In this study, the antioxidant and anti‐inflammatory activity of a novel extracellular polysaccharopeptide, sanghuang extracellular polysaccharopeptide (SePSP) was investigated. The SePSP was purified from the submerged fermentation broth of a sanghuang mycelium, Sanghuangporus lonicericola strain CBS17, which was isolated from a wild sanghuang fruiting body.RESULTSThe SePSP was extracted using an ethanol precipitation procedure, followed by diethylaminoethanol (DEAE) anion‐exchange and size‐exclusion chromatography. The mass ratio of the polysaccharide and peptide components in the purified SePSP was approximately 4.87:1. By determining its free radical scavenging abilities using 2,2‐diphenyl‐1‐picrylhydrazyl (DPPH), the hydroxyl free radical, and the superoxide anion free radical, as well as its total reducing power, SePSP was shown to have strong concentration‐dependent antioxidant activity in vitro. Further, SePSP effectively alleviated dextran sodium sulfate (DSS)‐induced ulcerative colitis (UC) in mice. Administration of 200 mg kg−1 SePSP by gavage for 7 days prevented body weight loss; significantly reduced the mRNA levels of proinflammatory cytokines, including TNF‐α and IL‐1β; increased mRNA level of the anti‐inflammatory cytokine IL‐10 in the colon, and decreased the malondialdehyde concentration from 6.42 to 4.82 μmol L−1 in the blood in UC mice.CONCLUSIONThe SePSP had strong concentration‐dependent antioxidant activity in vitro and effectively alleviated DSS‐induced UC in mice. The in vivo therapeutic efficacy in DSS‐induced UC may be mediated by modulating the expression of inflammatory cytokines and inhibiting oxidative stress. The findings provide a scientific rationale for the use of bioactive nutraceuticals from sanghuang mushrooms to develop functional foods for the prevention and treatment of UC. © 2020 Society of Chemical Industry

show abstract

Section: Methodsmentioning

confidence: 99%

Purification and antioxidant and anti‐Inflammatory activity of extracellular polysaccharopeptide from sanghuang mushroom, Sanghuangporus lonicericola

et al. 2020

View full text Add to dashboard Cite

show abstract

“…Current entomological reports from various regions indicate the widespread occurrence of tsetse flies, including Adamawa [27][28][29][30][31], North [32,33], East [34,35], North West [36], South West [37,38], Centre [39], Littoral [40], West [41] and South [42,43]. However, reports from the Far North region indicate the apparent absence of this fly-group [44].…”

Section: Introductionmentioning

confidence: 99%

“…In 2005, the first report on trypanocidal drug resistance was made in the Adamawa region of Cameroon [ 9 , 47 ]. More than 10 years later, trypanocidal resistance of T. congolense isolates in tsetse flies and ruminants (cattle and sheep) from Yoko in the Centre region of Cameroon was reported [ 39 , 48 ].…”

Section: Introductionmentioning

confidence: 99%

Spatial meta-analysis of the occurrence and distribution of tsetse-transmitted animal trypanosomiasis in Cameroon over the last 30 years

et al. 2022

View full text Add to dashboard Cite

In Cameroon, >90% of cattle are considered exposed to African animal trypanosomiasis (AAT) infection, with the presence of tsetse rendering cattle husbandry as a very difficult proposition. A systematic review of data on AAT and tsetse from 1990 to 2021 was conducted to develop a national atlas. The review identified 74 relevant scientific documents, with three pathogenic Trypanosoma species (Trypanosoma vivax, T. congolense and T. brucei s.l.) most frequently identified as causing AAT. Trypanosoma grayi, T. theileri, T. simiae and the human African trypanosomiasis causative agent T. brucei gambiense were also identified in a wide range of hosts. The tsetse fly fauna of Cameroon comprises nine species, with Glossina palpalis palpalis and G. fuscipes fuscipes the most widely distributed following their identification in seven and five of the 10 regions, respectively. Two species, Glossina nigrofusca and G. pallicera pallicera appeared to be rare and were restricted to both forest and protected areas. The presence of AAT is associated with the presence of tsetse in the livestock–human–wildlife interface of Cameroon. AAT occurs beyond the tsetse belts of the country where mechanical vectors are abundant. This study provides AAT and tsetse maps to support ongoing interventions in Cameroon.

show abstract

“…Since then, several other studies have identified resistant protozoan parasites in animals. Simo et al identified diminazene aceturate resistant trypanosomes in tsetse fly in Cameroon [ 15 ] whereas Obi et al detected multi-drug resistant Trypanosoma isolates in South Eastern Nigeria [ 16 ] and other countries [ 17 ].…”

Section: Introductionmentioning

confidence: 99%

“…inactivates drugs and make them ineffective [ 1 ]. Resistance to antiprotozoals has been via two main mechanisms: resistance-associated mutations in the protozoan parasite and selective pressure [ 15 ]. The selective pressure has been attributed to poor diagnosis (including laboratory confirmation) of most protozoal diseases, improper use of antiprotozoal drugs, poor drug quality, and non-compliance with the standard treatment regimen.…”

Section: Introductionmentioning

confidence: 99%

A cross-sectional questionnaire survey on knowledge of anti-protozoal drug use and resistance among AHPs in Kwara State, Nigeria

et al. 2022

View full text Add to dashboard Cite

Antimicrobial resistance is a global public health crisis. However, there is a paucity of data on anti-protozoal resistance (APR), especially in animals. Hence, we assessed the knowledge of prudent antiprotozoal drug usage (APU) and resistance among animal health practitioners (AHPs) in Kwara State, Nigeria.A cross-sectional survey of 435 AHPs was performed in Kwara State from the 5th of March to the 31st of July 2020 using a structured and validated questionnaire. We used logistic regression analysis to identify socio-demographic factors that are associated with the satisfactory perception of prudent APU and good knowledge of APR among AHPs.Our findings showed that 80.2% (n = 349) of the AHPs in Kwara state had a good knowledge of APR with a mean knowledge score of 5.8 ± 1.2. In the same vein, 75.6% (n = 329) of the AHPs had a satisfactory perception of prudent APU with a mean score of 3.84 ± 1.21. Only 10.1% of the AHPs had observed treatment failures after the use of anti-protozoal drugs. Most of the AHPs (75.6%) believed that APR poses a significant threat to animal production and health globally. Logistic regression analysis showed that female AHPs were more likely (OR: 2.17; 95% CI: 0.91, 5.20; p < 0.005) to have better knowledge of APR than their male counterparts. AHPs with tertiary education were likely (OR: 2.77; 95% CI: 0.96, 4.99; p < 0.05) to be more knowledgeable about APR and have satisfactory perceptions of APU (OR: 1.57; 95% CI: 1.16, 2.99; p = 0.07) respectively. Finally, veterinarians were 3.76 times (95% CI:1.26, 9.25; p < 0.001) more likely to have good knowledge of APR and better perceptions of APU (OR: 3.28; 95% CI: 1.89, 5.68; p < 0.001) than other AHPs respectively.To control antimicrobial resistance, continuous training of AHPs especially para-veterinary officers is essential to update their knowledge on prudent antimicrobial usage and prevent the emergence of resistant protozoan parasites.

show abstract

Molecular identification of diminazene aceturate resistant trypanosomes in tsetse flies from Yoko in the Centre region of Cameroon and its epidemiological implications

Cited by 13 publications

References 39 publications

Purification and antioxidant and anti‐Inflammatory activity of extracellular polysaccharopeptide from sanghuang mushroom, Sanghuangporus lonicericola

Purification and antioxidant and anti‐Inflammatory activity of extracellular polysaccharopeptide from sanghuang mushroom, Sanghuangporus lonicericola

Spatial meta-analysis of the occurrence and distribution of tsetse-transmitted animal trypanosomiasis in Cameroon over the last 30 years

A cross-sectional questionnaire survey on knowledge of anti-protozoal drug use and resistance among AHPs in Kwara State, Nigeria

Contact Info

Product

Resources

About