Molecular mechanism for the multiple sclerosis risk variant rs17594362

Abstract

Multiple sclerosis (MS) is known as an autoimmune demyelinating disease of the central nervous system. However, its cause remains elusive. Given previous studies suggesting that dysfunctional oligodendrocytes (OLs) may trigger MS, we tested whether single nucleotide polymorphisms (SNPs) associated with MS affect OL enhancers, potentially increasing MS risk by dysregulating gene expression of OL lineage cells. We found that two closely spaced OL enhancers, which are 3 Kb apart on chromosome 13, overlap two MS SNPs in linkage disequilibrium—rs17594362 and rs12429256. Our data revealed that the two MS SNPs significantly up-regulate the associated OL enhancers, which we have named as Rgcc-E1 and Rgcc-E2. Analysis of Hi-C data and epigenome editing experiments shows that Rgcc is the primary target of Rgcc-E1 and Rgcc-E2. Collectively, these data indicate that the molecular mechanism of rs17594362 and rs12429256 is to induce Rgcc overexpression by potentiating the enhancer activity of Rgcc-E1 and Rgcc-E2. Importantly, the dosage of the rs17594362/rs12429256 risk allele is positively correlated with the expression level of Rgcc in the human population, confirming our molecular mechanism. Our study also suggests that Rgcc overexpression in OL lineage cells may be a key cellular mechanism of rs17594362 and rs12429256 for MS.

RGCC balances self‐renewal and neuronal differentiation of neural stem cells in the developing mammalian neocortex

“…On the contrary, in some other tissues such as human aortic smooth muscle, overexpression of RGCC drove S‐phase entry and G2/M cycling (Badea et al , 2002). RGCC has also been reported to be associated with human nervous system disorders such as multiple sclerosis (Tegla et al , 2013; Kim & Park, 2019) and Alzheimer’s disease (Counts & Mufson, 2017). However, the specific roles of RGCC in neural development, and cortical development in particular, have not yet been studied.…”

“…Due to its roles in modulating cell cycle progression that were discovered in the past decades, it was renamed as regulator of cell cycle ( RGCC ) (Counts & Mufson, 2017). RGCC has been reported to regulate multiple cellular processes in various tissues such as kidney (Guo et al , 2011; Li et al , 2011), liver and adipose tissue (Cui et al , 2015), nervous system (Counts & Mufson, 2017; Kim & Park, 2019; Vlaicu et al , 2019), smooth muscle, and heart (Vlaicu et al , 2016) and has been implicated in many pathologic conditions, including cardiovascular (Cui & Chen, 2018), metabolic (Cui et al , 2015), renal (Li et al , 2011; Niu et al , 2011), autoimmune (Sun & Chen, 2018; Kim & Park, 2019), and neurodegenerative diseases (Counts & Mufson, 2017), as well as several cancers (Fosbrink et al , 2005; Vlaicu et al , 2010; Zhu et al , 2012; Sun et al , 2013; Xu et al , 2014). However, the roles of RGCC vary in different tissues and pathological processes.…”

A Systematic Strategy for Identifying Causal Single Nucleotide Polymorphisms and Their Target Genes on Juvenile Arthritis Risk Haplotypes

“…was generated as described previously (16)(17)(18). The dCas9-KRAB were co-transfected with SB100X into K562.…”

“…The sgRNA sequence for the HS2 enhancer (HS Cr4, gaaggttacacagaaccaga) was from (24). The gRNA expression vectors were generated as described previously (16)(17)(18). The sequence information of all constructs was verified by Sanger sequencing.…”

Identifying an oligodendrocyte enhancer that regulatesOlig2expression

“…We have recently developed an innovative method that links enhancers to target genes in a principled manner ( 22 ). Its power has been demonstrated for Myrf ( 22 ), Rgcc ( 23 ) and Plp1 ( 24 ). Here, we applied it to Olig2 in the context of OL lineage cells, uncovering an evolutionarily conserved OL enhancer for it.…”