Molecular phylogenetic reconstruction and localization of the (TTAGG)n telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863) suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera)

Abstract

Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known) and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known). The main exception is Acromyrmex striatus (Roger, 1863), which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH) with telomeric probes with (TTAGG)6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus. Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

Distinguishing Sichuan Walnut Cultivars and Examining Their Relationships with Juglans regia and J. sigillata by FISH, Early-Fruiting Gene Analysis, and SSR Analysis

“…Similar distribution patterns have also been observed in Citrus species (Deng et al, 2019); Berberis species (Liu and Luo, 2019); and Fraxinus, Syringa, and Ligustrum species (Luo and Liu, 2019a). FISH probes (AG 3 T 3 ) 3 located at chromosome ends ensure accurate chromosome counts (Pereira et al, 2018), although (AG 3 T 3 ) 3 is also occasionally observed in the internal positions of chromosomes (Murray et al, 2002;Majerová et al, 2014;Vasconcelos et al, 2018). Because 5S rDNA and (AG 3 T 3 ) 3 were inadequate for identifying the Sichuan walnut cultivars, it was necessary to perform further detection.…”

“…Fluorescence in situ hybridization (FISH) with probe-labeled chromosome ends enables accurate counting of small walnut chromosomes (Deng et al, 2019;Liu and Luo, 2019;Luo and Liu, 2019a). Karyotype analysis aids in chromosome physical map construction and chromosome assembly (Hizume et al, 2002;Luo et al, 2017;Luo et al, 2018;Pereira et al, 2018), thereby providing a guide for distinguishing Sichuan walnut cultivars to a certain degree. However, no walnut cultivars have been subjected to FISH analysis.…”

Phylogenetic patterns of ant–fungus associations indicate that farming strategies, not only a superior fungal cultivar, explain the ecological success of leafcutter ants

“…() dated the last common ancestor of these two clades to, respectively, 25 mya (range: 11–39 mya) and 22.4 mya (16.9–27.9 mya), suggesting that Clade‐A fungi may have originated before the origin of leafcutter fungiculture (see Mueller et al., for further discussion). The cultivation of a Clade‐B fungus by Acromyrmex striatus (Figure ), the most basal (earliest‐diverging) lineage in the leafcutter clade (Cristiano et al., ; Branstetter et al., ; Pereira, Reis, Cardoso, & Cristiano, ), would support a possible ancestral leafcutter fungiculture that included Clade‐B fungi. However, the cultivation of a mix of Clade‐A and Clade‐B fungi by species in the leafcutter clade and especially in the septentrionalis ‐clade of Trachymyrmex (sister clade to the leafcutter ant clade; Rabeling, Cover, Johnson, & Mueller, ; Schultz & Brady, ; Schultz et al., ) suggests the possibility of a mix of Clade‐A and Clade‐B cultivation that preceded the origin (most recent common ancestor) of leafcutter ants and the septentrionalis ‐clade.…”

Telomere structure in insects: A review

“…Specifically, the (TTAGG) n motif was initially considered characteristic of this order in general (Frydrychová et al, 2004). However, at that time this motif was detected only on chromosomes of certain aculeate Hymenoptera, i.e., the honeybee, Apis mellifera Linnaeus, 1758, from the family Apidae as well as about 20 ant species (Formicidae), using either FISH or SBH (Lorite, Carrillo, & Palomeque, 2002;Meyne & Imai, 1995; see also Korandová et al, 2014;Okazaki et al, 1993;Pereira, dos Reis, Cardoso, & Cristiano, 2018;Wurm et al, 2011). Interestingly, the telomeres of A. mellifera appeared to be a mosaic of short TTAGG repeats interspersed with TCAGGCTGGG, TCAGGCTGGGTTGGG, and TCAGGCTGGGTGAGGATGGG higher order repeat arrays (Garavís et al, 2013).…”