Molecular species identification of scat samples of South American felids and canids

Rodríguez-Castro, Karen Giselle; Saranholi, Bruno H.; Bataglia, Luana; Blanck, Danielly Veloso; Galetti, Pedro Manoel

doi:10.1007/s12686-018-1048-6

Cited by 12 publications

(11 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Studies have since used DNA barcoding in species discrimination of scat from Canids and other carnivores (Chaves et al . 2012; Rodríguez-Castro et al . 2018) as well as in frugivorous birds (González-Varo et al .…”

Section: Introductionmentioning

confidence: 99%

The total dispersal kernel: a review and future directions

et al. 2019

View full text Add to dashboard Cite

The distribution and abundance of plants across the world depends in part on their ability to move, which is commonly characterized by a dispersal kernel. For seeds, the total dispersal kernel (TDK) describes the combined influence of all primary, secondary and higher-order dispersal vectors on the overall dispersal kernel for a plant individual, population, species or community. Understanding the role of each vector within the TDK, and their combined influence on the TDK, is critically important for being able to predict plant responses to a changing biotic or abiotic environment. In addition, fully characterizing the TDK by including all vectors may affect predictions of population spread. Here, we review existing research on the TDK and discuss advances in empirical, conceptual modelling and statistical approaches that will facilitate broader application. The concept is simple, but few examples of well-characterized TDKs exist. We find that significant empirical challenges exist, as many studies do not account for all dispersal vectors (e.g. gravity, higher-order dispersal vectors), inadequately measure or estimate long-distance dispersal resulting from multiple vectors and/or neglect spatial heterogeneity and context dependence. Existing mathematical and conceptual modelling approaches and statistical methods allow fitting individual dispersal kernels and combining them to form a TDK; these will perform best if robust prior information is available. We recommend a modelling cycle to parameterize TDKs, where empirical data inform models, which in turn inform additional data collection. Finally, we recommend that the TDK concept be extended to account for not only where seeds land, but also how that location affects the likelihood of establishing and producing a reproductive adult, i.e. the total effective dispersal kernel.

show abstract

Section: Introductionmentioning

confidence: 99%

The total dispersal kernel: a review and future directions

et al. 2019

View full text Add to dashboard Cite

show abstract

“…PCR was performed on the carnivore faecal samples using the forward primer Car12Ss2 (5 'GGTTTGGTCC TRGCCTT 3') and the reverse primer Car12Ss2 (5 'AGCAAGGTGTTATGAGCTAC 3'), which amplify a 12S mitochondrial gene fragment [57]. Samples that presented low-quality electropherograms were also submitted to PCR using the forward primer ATP6-DF3 (5 'AACGAAAATCTATTCGCCTCT 3') and reverse primer ATP6-DR1 (5 'CCAGTATTTGTTTTGATGTTAG TTG 3'), which amplify a fragment of the ATP6 mitochondrial gene.…”

Section: Polymerase Chain Reaction (Pcr) Sequencing and Phylogeneticmentioning

confidence: 99%

Non-invasive sampling in Itatiaia National Park, Brazil: wild mammal parasite detection

et al. 2020

View full text Add to dashboard Cite

Background: Non-invasive sampling through faecal collection is one of the most cost-effective alternatives for monitoring of free-living wild mammals, as it provides information on animal taxonomy as well as the dynamics of the gastrointestinal parasites that potentially infect these animals. In this context, this study aimed to perform an epidemiological survey of gastrointestinal parasites using non-invasive faecal samples from carnivores and artiodactyls identified by stool macroscopy, guard hair morphology and DNA sequencing in Itatiaia National Park. Between 2017 and 2018, faeces from carnivores and artiodactyls were collected along trails in the park. The host species were identified through macroscopic and trichological examinations and molecular biology. To investigate the parasites, the Faust, Lutz and modified Ritchie and Sheather techniques and enzyme immunoassays to detect Cryptosporidium sp. antigens were used. Results: A total of 244 stool samples were collected. The species identified were Chrysocyon brachyurus, Leopardus guttulus, Canis familiaris, Cerdocyon thous, Puma yagouaroundi, Leopardus pardalis, Puma concolor and Sus scrofa. There were 81.1% samples that were positive for parasites distributed mainly in the high part of the park. Helminths, especially eggs of the family Ascarididae, were more frequently detected in carnivore faeces (70.9%). Protozoa, especially Cryptosporidium sp., represented the highest frequency of infection in artiodactyl faeces (87.1%). This zoonotic protozoon was detected in eight mammalian species, including in a wild boar. High values of structural richness and Shannon and Simpson diversity indices were observed for the parasites, especially in the faeces of C. brachyurus. Significant differences in parasite diversity were observed between wild and domestic animals, such as C. brachyurus and C. familiaris, respectively, and between taxonomically distant species, such as C. brachyurus and S. scrofa. The highest values for parasite similarity were found among the species that frequented similar areas of the park, such as C. brachyurus and L. guttulus.

show abstract

“…Another primitive also used was the cytochrome C and oxidase I subunit (COI), which amplifies about 650 base pairs and which was initially described to identify insects but which has also been widely used for the study of vertebrates [25]. In the case of animals inserted at high levels of the food chain, "universal primers" are poorly indicated for the identification of the predator because they also amplified nucleotide fragments of other animals, such as prey, and are therefore nonspecific [26][27][28]. All over the years, the mitochondrial genome has been extensively studied in the free-living mammals, such as the 16S region [28], the control region [29], ATP6 [28,30], and 12S [27].…”

Section: Animal Identification From Noninvasive Samplesmentioning

confidence: 99%

“…In the case of animals inserted at high levels of the food chain, "universal primers" are poorly indicated for the identification of the predator because they also amplified nucleotide fragments of other animals, such as prey, and are therefore nonspecific [26][27][28]. All over the years, the mitochondrial genome has been extensively studied in the free-living mammals, such as the 16S region [28], the control region [29], ATP6 [28,30], and 12S [27]. These genetic markers enhance the chances of success in polymerase chain reaction (PCR), since they amplify smaller DNA fragments and increases the probability of degraded DNA detection in noninvasive samples [28].…”

Section: Animal Identification From Noninvasive Samplesmentioning

confidence: 99%

“…All over the years, the mitochondrial genome has been extensively studied in the free-living mammals, such as the 16S region [28], the control region [29], ATP6 [28,30], and 12S [27]. These genetic markers enhance the chances of success in polymerase chain reaction (PCR), since they amplify smaller DNA fragments and increases the probability of degraded DNA detection in noninvasive samples [28].…”

Section: Animal Identification From Noninvasive Samplesmentioning

confidence: 99%

See 1 more Smart Citation

Noninvasive Sampling: Monitoring of Wild Carnivores and Their Parasites

Dib¹,

Palmer²,

Lima³

et al. 2020

Protected Areas, National Parks and Sustainable Future

View full text Add to dashboard Cite

This chapter aims to present the importance, advantages, and disadvantages as well as the different types of noninvasive samples that can be used to monitor the carnivorous fauna and the parasitic agents that can infect these animals. This issue is extremely relevant, since noninvasive sampling has been increasingly used in different scientific researches that study animals with elusive habits, such as carnivores, and that claim animal welfare, once these animals do not need to be observed or captured. It is still important to highlight the scarcity of studies on parasitic diseases in free-living carnivores, being needed that parasitological surveys be done frequently by the conservation unit managers also to monitor the infectious agents that may be being introduced into the ecosystem of carnivores due to anthropization.

show abstract

Molecular species identification of scat samples of South American felids and canids

Cited by 12 publications

References 30 publications

The total dispersal kernel: a review and future directions

The total dispersal kernel: a review and future directions

Non-invasive sampling in Itatiaia National Park, Brazil: wild mammal parasite detection

Noninvasive Sampling: Monitoring of Wild Carnivores and Their Parasites

Contact Info

Product

Resources

About