Molecular structure of the human muscle-specific enolase gene (<i>ENO3</i>)

Peshavaria, Mina; Day, Ian N.M.

doi:10.1042/bj2750427

Cited by 48 publications

(36 citation statements)

References 57 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Truncated and mutated metallothionein (MT) and ␤-enolase promoters were constructed by using oligonucleotides to prime PCRs with the respective parent plasmids (pMT-CAT and pEno 628 -luc). The PCR primers, based on published sequences (42,59), were as follows: Eno wild type (WT), 5Ј TTTCTCGAGGCCCAGTGTGAAGGGGGGAGGATGGAGAGA AAGAGAGGCGGGGCTGGCT; Eno (mutant), 5Ј TTCTCGAGGCCCAGTG TGAAGGGGGGAGGATGGAGAGAAAGAGAAATGGGGCTGGCT; Eno, 5Ј TTTAAGCTTCTTGGGATGTCTTCGCTGGAG (antisense); MT IIA (wild type [WT]), 5Ј TTTCTCGAGGCGGGGCGTGTGCAGGCACGCCCG GGGCGGGGC; MT IIA (mutant [M]), 5Ј TTTCTCGAGGCGGGGCGTGTG CAGGCACGAATGGGGCGGGGC; MT IIA, 5Ј TTTAAGCTTGGGACTTG GAGGAGGCGTGGTGGAGTGCAG (antisense). All primers contained XhoI cloning sequences on the 5Ј end and HindIII sequences on the 3Ј end.…”

Section: Methodsmentioning

confidence: 99%

Physical and Functional Sensitivity of Zinc Finger Transcription Factors to Redox Change

Bishopric

Discher

et al. 1996

Molecular and Cellular Biology

189

136

View full text Add to dashboard Cite

Redox regulation of DNA-binding proteins through the reversible oxidation of key cysteine sulfhydryl groups has been demonstrated to occur in vitro for a range of transcription factors. The direct redox regulation of DNA binding has not been described in vivo, possibly because most protein thiol groups are strongly buffered against oxidation by the highly reduced intracellular environment mediated by glutathione, thioredoxin, and associated pathways. For this reason, only accessible protein thiol groups with high thiol-disulfide oxidation potentials are likely to be responsive to intracellular redox changes. In this article, we demonstrate that zinc finger DNA-binding proteins, in particular members of the Sp-1 family, appear to contain such redox-sensitive -SH groups. These proteins displayed a higher sensitivity to redox regulation than other redox-responsive factors both in vitro and in vivo. This effect was reflected in the hyperoxidative repression of transcription from promoters with essential Sp-1 binding sites, including the simian virus 40 early region, glycolytic enzyme, and dihydrofolate reductase genes. Promoter analyses implicated the Sp-1 sites in this repression. Non-Sp-1-dependent redox-regulated genes including metallothionein and heme oxygenase were induced by the same hyperoxic stress. The studies demonstrate that cellular redox changes can directly regulate gene expression in vivo by determining the level of occupancy of strategically positioned GC-binding sites.There is compelling evidence for both direct and indirect pathways for the regulation of gene expression by changes in cellular redox state. Hypoxic and hyperoxic stresses can activate or repress the transcription of certain genes by pathways that probably involve protein kinases (5,16,18,24,28,52,68,70,82,84). The response to severe oxidative stress may involve an additional effect in which redox-sensitive factors can be directly activated or inactivated through the oxidation of sulfhydryl residues. The binding of factors AP-1, Sp-1, Egr-1, NF-B, v-rel, c-myb, E2, IRE-BP, p53, and USF to nucleic acid is reduced or lost when critical cysteine residues are oxidized or alkylated (1, 3, 4, 33-35, 37, 48, 53, 60, 66, 78, 89). HoxB5, a member of the mammalian homeodomain gene family, is an example of a factor that is activated by oxidation (30). In the case of AP-1, a cellular DNA-repair protein that may regulate the redox equilibrium has been described previously (90). Oxidative inactivation of USF has been shown to correlate directly with transcriptional activity in an in vitro assay (60). It has been proposed that the reactive cysteines may constitute redox-sulfhydryl switches which directly regulate gene expression (35,60). In support of this, factor Sp-1 in rat liver appears to become progressively oxidized during aging, resulting in the reversible loss of binding activity by an in vitro assay (3). To date, there have been no reports to demonstrate that oxidizing agents or redox stresses can directly mediate transcription factor bindi...

show abstract

Section: Methodsmentioning

confidence: 99%

Physical and Functional Sensitivity of Zinc Finger Transcription Factors to Redox Change

Bishopric

Discher

et al. 1996

Molecular and Cellular Biology

189

136

View full text Add to dashboard Cite

show abstract

“…α-enolase, known as non-neuronal enolase (NNE) or enolase-1 is expressed in various tissues like brain, kidney, liver. β-enolase or enolase-3 is mainly present in skeletal muscle cells (Peshavaria and Day, 1991). Neuron-specific enolase (NSE), the γ homodimer of enolase, was first found in extracts of brain tissue, and was later shown to be present in APUD (amine precursor uptake and decarboxylation) cells.…”

Section: Introductionmentioning

confidence: 99%

“…Enolase, also known as phosphopyruvate hydratase is an enzyme responsible for the catalysis of the conversion of 2-phospho-D-glycerate (2-PG) to phosphoenolpyruvate (PEP) in the glycolytic pathway (Peshavaria and Day, 1991). It also catalyses the reaction of PEP to 2-PG in gluconeogenesis.…”

Section: Introductionmentioning

confidence: 99%

For Which Cancer Types can Neuron-Specific Enolase be Clinically Helpful in Turkish Patients?

Bilgin

Dizdar²,

Serilmez³

et al. 2013

Asian Pacific Journal of Cancer Prevention

View full text Add to dashboard Cite

“…As a first step towards the understanding this mechanism(s), we have determined the complete primary structure of the human p enolase gene. While this work was in progress, Peshvaria and Day [14] reported a partial sequence of the human muscle-specific enolase gene and suggested the presence of micro-heterogeneity in the untranslated first exon. In this report, we demonstrate the existence, in human muscle, of two forms of p enolase transcript that differ in their 5'-untranslated sequence and are generated by alternative splicing.…”

mentioning

confidence: 99%

Structural features of the human gene for muscle‐specific enolase

Giallongo

Venturella

Oliva

et al. 1993

European Journal of Biochemistry

View full text Add to dashboard Cite

We report here the isolation and characterization of the human gene for the p or muscle-specific isoform of the glycolytic enzyme enolase. The nucleotide sequence analysis revealed structural features, such as organization as 11 coding exons, the first exon consisting of an untranslated sequence and hence resembling sequences of the other two members of the gene family, the a and y enolase genes. The p enolase locus spans about 6 kbp genomic DNA. Sequences matching the consensus sequence for muscle-specific regulatory factors are present in the 5'-flanking region and within the first intron. A combination of primer extension, S1 nuclease protection and RNA-sequencing experiments indicates that the gene has a unique transcriptional start site, 26 bp downstream of a TATA-like box; the differential usage of two donor sites within the untranslated exon I generates two alternatively spliced transcripts. The existence of the two mRNA, differing from one another in the presence or absence of a 42-nucleotide fragment in the leader sequence, was confirmed by cloning the corresponding cDNA using the rapid amplification of cDNA ends strategy. Secondarystructure predictions indicated that the leader sequences of the spliced forms could form hairpin structures with different free energies of formation, suggesting translational control.

show abstract

Molecular structure of the human muscle-specific enolase gene (ENO3)

Cited by 48 publications

References 57 publications

Physical and Functional Sensitivity of Zinc Finger Transcription Factors to Redox Change

Physical and Functional Sensitivity of Zinc Finger Transcription Factors to Redox Change

For Which Cancer Types can Neuron-Specific Enolase be Clinically Helpful in Turkish Patients?

Structural features of the human gene for muscle‐specific enolase

Contact Info

Product

Resources

About